ID: 1158879125

View in Genome Browser
Species Human (GRCh38)
Location 18:61759800-61759822
Sequence GAAGCAACCTAGACACTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158879124_1158879125 -10 Left 1158879124 18:61759787-61759809 CCATGTCAAAGGAGAAGCAACCT No data
Right 1158879125 18:61759800-61759822 GAAGCAACCTAGACACTGAAAGG No data
1158879123_1158879125 -9 Left 1158879123 18:61759786-61759808 CCCATGTCAAAGGAGAAGCAACC No data
Right 1158879125 18:61759800-61759822 GAAGCAACCTAGACACTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158879125 Original CRISPR GAAGCAACCTAGACACTGAA AGG Intergenic
No off target data available for this crispr