ID: 1158881018

View in Genome Browser
Species Human (GRCh38)
Location 18:61779715-61779737
Sequence ATTGAAGCTGGGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158881018_1158881023 4 Left 1158881018 18:61779715-61779737 CCCAGCTCCATCCCAGCTTCAAT No data
Right 1158881023 18:61779742-61779764 TTCTCACTCTGCACACCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158881018 Original CRISPR ATTGAAGCTGGGATGGAGCT GGG (reversed) Intergenic