ID: 1158886365

View in Genome Browser
Species Human (GRCh38)
Location 18:61830660-61830682
Sequence AGGCTGAACTAAAGGAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 454}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158886360_1158886365 12 Left 1158886360 18:61830625-61830647 CCACTCTGGCAGCAGAGTGAGAT 0: 1
1: 0
2: 10
3: 275
4: 2375
Right 1158886365 18:61830660-61830682 AGGCTGAACTAAAGGAAAGAGGG 0: 1
1: 0
2: 0
3: 34
4: 454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158886365 Original CRISPR AGGCTGAACTAAAGGAAAGA GGG Intronic
900669646 1:3843144-3843166 TGCCTGGTCTAAAGGAAAGAAGG - Intronic
901096340 1:6683145-6683167 AGTCTGCACCAAAGGGAAGATGG - Intronic
901259002 1:7857315-7857337 AGGTTGAATTACAGGAGAGATGG - Intergenic
903768764 1:25751022-25751044 AGGAAGAACGGAAGGAAAGATGG - Intronic
903781171 1:25820753-25820775 GCGCTGAACTAAACGAATGAAGG - Intronic
904700296 1:32353870-32353892 AGGCTGAAGATAAGGAAAAATGG - Intronic
904929952 1:34078988-34079010 AGTCTGGACTAAAGCAATGAAGG - Intronic
904930519 1:34083265-34083287 AGGCTGAGATGTAGGAAAGAGGG + Intronic
906094940 1:43216515-43216537 AGGCTGAACCAAAGGCCTGAAGG + Intronic
906819628 1:48915747-48915769 CTGCTGTACTAAAGGATAGAAGG + Intronic
906999453 1:50835230-50835252 AAGCTTAACTAAAGGAAATAAGG + Intronic
908905434 1:69003529-69003551 AGCCTGAAATCAAGGACAGATGG + Intergenic
909040336 1:70641976-70641998 ATCCATAACTAAAGGAAAGAGGG - Intergenic
909384322 1:75037492-75037514 AGGCTGCAGAACAGGAAAGATGG - Intergenic
909755971 1:79226036-79226058 AGGCTGCACTTAAAGAAGGAAGG - Intergenic
910793006 1:91070459-91070481 GGCCTGCACTAAAGGATAGAGGG + Intergenic
911740716 1:101384287-101384309 AGGCAGAACTCAGGGAAGGATGG + Intergenic
912018205 1:105069505-105069527 AGGCAGAAAGAAAGGAAAGAAGG - Intergenic
912077571 1:105894690-105894712 AGGCTGAGTTAAGGGAATGAAGG + Intergenic
916485909 1:165258250-165258272 TGGCTAAACTGAAGGAGAGATGG + Intronic
916841057 1:168601237-168601259 GGGCTGAAATAAACGAAAGATGG - Intergenic
917034064 1:170726874-170726896 AGGAAGAAAGAAAGGAAAGAAGG + Intronic
917292993 1:173490562-173490584 AGGCTGAATAAGAGGTAAGAGGG - Intergenic
917364242 1:174211553-174211575 AGGATGACAGAAAGGAAAGAAGG + Intronic
917714709 1:177722379-177722401 AGGCTGCAAAACAGGAAAGATGG - Intergenic
918547967 1:185707382-185707404 AGGCTGAACAAAAAAAAAGATGG + Intergenic
918574851 1:186045673-186045695 TGGCGGAACTACATGAAAGATGG - Exonic
918833946 1:189435437-189435459 AGGATAGAGTAAAGGAAAGAGGG + Intergenic
919312857 1:195933216-195933238 TGGCTGAACTGAAGGAAATGTGG - Intergenic
919710478 1:200722392-200722414 AGACAGAAAGAAAGGAAAGAAGG + Intergenic
920615947 1:207492713-207492735 ACACTGAACTATGGGAAAGAGGG + Intergenic
920649455 1:207825825-207825847 AGGCAGAACTAGAGGGAAGTAGG + Intergenic
921509514 1:216011937-216011959 AGGCTGAGGAACAGGAAAGAAGG - Intronic
921545976 1:216475670-216475692 AGGCTGAAGGAAAGGAAGGAAGG + Intergenic
922551733 1:226499028-226499050 GGGCTGAAATAAAGAAAAGGAGG - Intergenic
924214136 1:241802650-241802672 AAGATGAACTAATGGATAGAGGG + Intergenic
924895924 1:248338000-248338022 AGGGTGAGCAACAGGAAAGAAGG + Intergenic
1063156280 10:3382144-3382166 AGGAAGAAAGAAAGGAAAGAAGG + Intergenic
1063738297 10:8787914-8787936 AGGGTGAAATAAAGTCAAGAGGG + Intergenic
1063753563 10:8980020-8980042 TAGCTGAACTGATGGAAAGATGG + Intergenic
1063959691 10:11297087-11297109 AGGGAGAACAAAAGGAAAGGAGG + Intronic
1064578354 10:16768695-16768717 AGGAGGACCTGAAGGAAAGAAGG - Intronic
1064871019 10:19937126-19937148 AGGATGAACTGAAGGAATGGAGG - Intronic
1064905869 10:20344854-20344876 AGCCTGAAGTAAATGAAAGTGGG + Intergenic
1064932821 10:20645841-20645863 AGGTCTAACTAAAGGAAATATGG + Intergenic
1064996128 10:21298058-21298080 AGGAAGAAGGAAAGGAAAGAGGG + Intergenic
1065502723 10:26398079-26398101 AGGATGAAGTAAAGAGAAGAGGG - Intergenic
1068194660 10:53700061-53700083 AGGCTGTTCTGATGGAAAGAAGG - Intergenic
1069147258 10:64909514-64909536 AAGATGAACAAAATGAAAGAAGG + Intergenic
1070095526 10:73334508-73334530 AGGTAGAACAAAAGGAAAGACGG + Intronic
1071539303 10:86466058-86466080 AAACTGAACTAAAGCAAAAATGG + Intronic
1071592622 10:86889420-86889442 AGGCACAAATAAAGGAAAGCTGG + Intronic
1071871191 10:89796476-89796498 AGGTTGGAGTAAAGGAAAGAGGG - Intergenic
1073432728 10:103497024-103497046 AGCCTGAAATGAAGGACAGAAGG + Intronic
1073555194 10:104443298-104443320 AGGCTGGAGTGAAGGCAAGATGG + Intronic
1077985880 11:7350528-7350550 AGGCTGAGACATAGGAAAGAGGG - Intronic
1078033791 11:7781194-7781216 AGGCTGCAAAAAAGCAAAGATGG - Intergenic
1078038336 11:7832749-7832771 AGACAGAACAAAATGAAAGAAGG + Intergenic
1078842429 11:15091370-15091392 AGGCCCAACTCTAGGAAAGAAGG + Intergenic
1078985442 11:16590409-16590431 TAGCTGAACTAAAGGAACAAAGG + Intronic
1079445681 11:20554441-20554463 TGGCTGAAGCAAAGGAAGGAAGG - Intergenic
1079700341 11:23538511-23538533 AAGCTGAACTAAATGAAACTGGG - Intergenic
1080576207 11:33601457-33601479 AAGATGAACCAAAGGAAGGAAGG + Intronic
1080783028 11:35448975-35448997 AGGCTGCAGCAAAGCAAAGATGG + Intronic
1081291501 11:41331221-41331243 AGGAATAACTCAAGGAAAGAAGG - Intronic
1081334851 11:41852399-41852421 AGGAGGAATGAAAGGAAAGAAGG - Intergenic
1082765207 11:57162265-57162287 AGGAGGAGCTAAAGGAATGAGGG + Intergenic
1082812725 11:57488393-57488415 AGGCTGAACTCAGGGAGTGATGG + Intronic
1083175791 11:60949342-60949364 AGGAAGAAAGAAAGGAAAGAAGG + Intronic
1083252809 11:61479088-61479110 AGGCTGAATAAAGGGAAAGGAGG - Intronic
1083738085 11:64693167-64693189 AGGCAGAACTGGAGGAAGGAGGG + Intronic
1084486589 11:69451722-69451744 AGGTTGAATGGAAGGAAAGAAGG + Intergenic
1084545709 11:69814060-69814082 AGGATGAGAGAAAGGAAAGAAGG + Intronic
1085682859 11:78594609-78594631 AGGCTAAAATAAAGGCAAGACGG - Intergenic
1085747036 11:79123766-79123788 AGGATGAACTGAAGAACAGAGGG + Intronic
1086435010 11:86771585-86771607 AGACTGAATTAAAGAAAAGCAGG - Intergenic
1087086557 11:94225059-94225081 AGACAGAAATACAGGAAAGAAGG - Intergenic
1087598151 11:100280756-100280778 AGGCAGGAAGAAAGGAAAGAAGG - Intronic
1089071098 11:115700326-115700348 AGGCTGAAAGAAAAGAATGAGGG - Intergenic
1089457529 11:118634247-118634269 AGGCTGAACTTCAGGGATGAGGG - Intronic
1089752526 11:120661507-120661529 AGGCTGACTTAGAGCAAAGATGG + Intronic
1090117025 11:123984477-123984499 AGGCTGAAGGACAGCAAAGATGG + Intergenic
1090120934 11:124027323-124027345 AGTTTGACATAAAGGAAAGAAGG - Intergenic
1090907969 11:131094194-131094216 GGGGAGAAGTAAAGGAAAGAAGG - Intergenic
1091007609 11:131967575-131967597 AGGCAGAGATAAAGGGAAGAAGG + Intronic
1091124957 11:133085982-133086004 AGGATGGAATAAAGCAAAGAAGG - Intronic
1093721408 12:22446576-22446598 AAGCTAAAAAAAAGGAAAGATGG + Intergenic
1094000949 12:25693454-25693476 AGGATGAAGGAAAGGAGAGAAGG + Intergenic
1094048902 12:26197547-26197569 AAGCTGCAATAAAGGAAGGATGG - Intronic
1094156657 12:27344524-27344546 AGGCTGAACTCCAGCACAGACGG + Intronic
1095510159 12:42942882-42942904 AGGTTGAAATGAAGGAAAAACGG - Intergenic
1095778479 12:46034295-46034317 AGGGTGAGGAAAAGGAAAGAAGG - Intergenic
1097237260 12:57549069-57549091 AGTCTGACCCAAAGGAAGGAAGG + Intergenic
1097312129 12:58130986-58131008 TGGCTGAACAAAAAGGAAGAAGG + Intergenic
1097643035 12:62205166-62205188 AGGCTGCACAATAGCAAAGATGG + Intronic
1098039125 12:66336507-66336529 AGGCTGTAATAAAGGTAAGAAGG + Intronic
1098131442 12:67354656-67354678 AGGCAGAGCTGAGGGAAAGAGGG + Intergenic
1098149058 12:67527883-67527905 ACGCGAAACAAAAGGAAAGAAGG - Intergenic
1098438602 12:70495644-70495666 AAGTTGAAATAAAGGAAAAAAGG - Intergenic
1098694733 12:73538036-73538058 AGGCTGAAGAACAGCAAAGATGG - Intergenic
1099031065 12:77526016-77526038 AGGCTAAAATAAAGGAATGGAGG + Intergenic
1099614554 12:84918100-84918122 AGACTGAACTCAAAGAAAGTAGG - Intergenic
1100341885 12:93687090-93687112 AGGCTGACATAAAGGAAAAGCGG + Intronic
1100515450 12:95323137-95323159 AGGAAGAAAGAAAGGAAAGAAGG + Intergenic
1101200286 12:102428366-102428388 AAGCTGAATTTAAGGAAAGCAGG + Intronic
1101854410 12:108430129-108430151 AGGCAGAACTGAAGGAAGGAAGG + Intergenic
1102247566 12:111364970-111364992 AGGCTGACTTACAGGAAGGAGGG + Intronic
1102854921 12:116285575-116285597 AGAAAGAAATAAAGGAAAGAAGG + Intergenic
1103839985 12:123855144-123855166 AGGCAGAACAAAAGGAAAAGTGG + Intronic
1103887148 12:124210994-124211016 AGGATGACTTAAATGAAAGAGGG + Intronic
1105053586 12:133077825-133077847 ATGGTGAACTGAAGGGAAGAAGG - Intergenic
1105201529 13:18183888-18183910 AGGTTGAAATGAAGGAAAAAAGG + Intergenic
1105859957 13:24400066-24400088 AGGCTGAAAAACAGCAAAGATGG - Intergenic
1106200710 13:27534638-27534660 AGGTGGCAGTAAAGGAAAGAAGG - Intergenic
1106240707 13:27910638-27910660 CAGCTGCACTATAGGAAAGATGG + Intergenic
1107458623 13:40578959-40578981 ATGCTGATCTAATGGCAAGACGG + Intronic
1108919295 13:55656730-55656752 AGGGTGAGCAACAGGAAAGAAGG + Intergenic
1108947720 13:56044458-56044480 AGGCTGAGGAACAGGAAAGAGGG - Intergenic
1109474001 13:62854037-62854059 AGAATGAAAGAAAGGAAAGAAGG - Intergenic
1109564064 13:64087704-64087726 AGGAAGAAAGAAAGGAAAGAAGG + Intergenic
1112019006 13:95355424-95355446 AGTCAGAAAAAAAGGAAAGAGGG - Intergenic
1113261541 13:108570216-108570238 AGGAAGAACAGAAGGAAAGAAGG - Intergenic
1115008011 14:28510197-28510219 AGGTTGAAATGAAGGAAAAAAGG - Intergenic
1115262991 14:31472624-31472646 AGCCTGAACTAAACTAAAGTGGG + Intergenic
1115591580 14:34871012-34871034 AGGCTGAACTCACTCAAAGATGG + Intronic
1115801716 14:37001595-37001617 AGAATGAAAAAAAGGAAAGAAGG - Intronic
1116173315 14:41430556-41430578 AGGAGGAACAAAAGGAACGAAGG - Intergenic
1116284171 14:42950485-42950507 AGAAAGAACTAAAGGAAGGAAGG + Intergenic
1116353171 14:43892456-43892478 TGGCTAAAATAAAGGAAAAAAGG - Intergenic
1116583505 14:46672993-46673015 AGGCAGAAGTAAAGGAAATGAGG + Intergenic
1117152692 14:52905387-52905409 ATGCTGAATTAAAGTAAAAAAGG - Intronic
1117172581 14:53115437-53115459 AGGCTGAAACAAAGGAAAAAAGG + Intronic
1117289398 14:54317911-54317933 AATGTGAACTATAGGAAAGAAGG - Intergenic
1117827584 14:59719567-59719589 TGGTTGAATCAAAGGAAAGATGG + Intronic
1118090608 14:62472540-62472562 AGGAGGAACTAGAGCAAAGATGG + Intergenic
1119969868 14:78958291-78958313 AGGCTGAGGTACAAGAAAGAGGG + Intronic
1120055201 14:79916243-79916265 AGGAAGAATTAAAGGAAACAGGG - Intergenic
1120515200 14:85462246-85462268 AGGAAGAAAGAAAGGAAAGAGGG - Intergenic
1120819136 14:88895851-88895873 AGGATGAAGTCTAGGAAAGATGG + Intergenic
1120931356 14:89851810-89851832 AGGCTAAAGTAAAAGGAAGAGGG + Intronic
1121396427 14:93627653-93627675 TGGCTGAACCAAAGTCAAGAGGG + Intronic
1123791463 15:23724643-23724665 AAGCAGAATTAAAGGGAAGATGG - Intergenic
1124046446 15:26155345-26155367 AGGCTGAAGAATAGCAAAGATGG + Intergenic
1124134183 15:27019616-27019638 AGGCAGAACTGAAGGAAGGTTGG + Intronic
1124662369 15:31560764-31560786 AGGCTGAACTGGAGGACAGTGGG - Intronic
1125672041 15:41480744-41480766 AGGCTAAATCAAAGGAAAGGAGG - Exonic
1125907895 15:43410132-43410154 AGGCAGAACTAGAGGAAATGGGG - Intronic
1128125385 15:65188589-65188611 ATTCTTAAGTAAAGGAAAGATGG - Intergenic
1129105403 15:73303928-73303950 AGACTGAACTAGAGAGAAGAAGG - Exonic
1130923806 15:88370253-88370275 AGGCAGGACACAAGGAAAGATGG + Intergenic
1131105975 15:89735004-89735026 AGGATGCACGGAAGGAAAGAAGG - Intronic
1131358649 15:91769125-91769147 AGGCTGATCTGATGGAAAGGTGG - Intergenic
1131545319 15:93311017-93311039 ATCCTGGACAAAAGGAAAGATGG - Intergenic
1131616431 15:94021422-94021444 AGGCTTAGCTTAAGGAAATAAGG - Intergenic
1132117656 15:99149385-99149407 AGGCCAAACCAAAGGAAAAAGGG + Intronic
1133447550 16:5874983-5875005 AGGCAGAACTAGAGGTTAGAGGG + Intergenic
1133698265 16:8285778-8285800 AGGCTGAAATGAAGGAAGGAAGG - Intergenic
1133698282 16:8285857-8285879 AGGATGGAATGAAGGAAAGAAGG - Intergenic
1135602949 16:23798714-23798736 TGGAAGAACTAGAGGAAAGAAGG + Intergenic
1135724271 16:24842712-24842734 AGGCTCAAGAACAGGAAAGATGG - Intergenic
1135935862 16:26779442-26779464 AGGCAGAAGTAGAGGAAAGAAGG - Intergenic
1136148019 16:28327274-28327296 AGGCTAAATTAAAGGATAGAAGG - Intergenic
1138111158 16:54325061-54325083 AGGTGGAATTAAGGGAAAGAAGG - Intergenic
1138890326 16:61135374-61135396 AGGCTGAAAAAGAGGAGAGAGGG + Intergenic
1138980671 16:62264405-62264427 AGGAGGAAGTAAAGGAAGGAAGG - Intergenic
1140083339 16:71771922-71771944 AGTCTCTACTAAAGAAAAGATGG + Intronic
1140659130 16:77170595-77170617 TGGCTGAACTCCAGGAAAAATGG - Intergenic
1140799918 16:78476944-78476966 AGGGTGAAAAAGAGGAAAGAGGG - Intronic
1140894964 16:79316845-79316867 ATGCTGGACTGAAAGAAAGAGGG + Intergenic
1141395400 16:83700080-83700102 GGGCTGAGGTAAAGGAAAGGAGG - Intronic
1143396131 17:6598894-6598916 AGGCTGAATGAAAGGAAATGAGG + Intronic
1144103981 17:11969692-11969714 AGGCTGAGCTGAAGGAATGTGGG + Exonic
1144499789 17:15775988-15776010 AGGAAGAAAGAAAGGAAAGAAGG - Intergenic
1145020109 17:19423507-19423529 AGGGTGTTCTAGAGGAAAGATGG - Intergenic
1146785859 17:35720775-35720797 AGGATGAAGAATAGGAAAGAGGG - Intronic
1149239482 17:54632299-54632321 AGGCTAAGAAAAAGGAAAGATGG + Intergenic
1150348207 17:64421045-64421067 AGGCTGAGCACAAGGAAGGAAGG - Intergenic
1151696863 17:75722277-75722299 AGGCTGAGCCATGGGAAAGAGGG - Intronic
1151739985 17:75974662-75974684 AGCATGAACTAAAGGACAGAAGG + Intronic
1152481279 17:80555236-80555258 AGGCAGAGCGAATGGAAAGAGGG - Intronic
1153015322 18:577802-577824 AAGCTGAACTAAAAGCAAAACGG - Intergenic
1153333944 18:3902669-3902691 AAGCTAAACTAAAAGAAACATGG - Intronic
1153366339 18:4261215-4261237 AAGCTGAACTAATGAAAACAGGG + Intronic
1154019655 18:10651652-10651674 AGGTTGAAATGAAGGAAAAAAGG + Intergenic
1155743485 18:29320043-29320065 CATCTGAAATAAAGGAAAGAGGG + Intergenic
1155933666 18:31732253-31732275 AAGCAGAAATAAATGAAAGACGG + Intergenic
1156168174 18:34449294-34449316 AGGATGAAAGAAAGGAAAGAAGG - Intergenic
1156278541 18:35609183-35609205 AGGCAGAAGAAAAGTAAAGAGGG - Intronic
1156645148 18:39152095-39152117 AGGATGAAATAAAAGAAAAATGG - Intergenic
1156659228 18:39326923-39326945 AGGCAGAACCAAAAGACAGAGGG + Intergenic
1158181768 18:54724375-54724397 AGGCTACACTAAAGGGAACAAGG + Intronic
1158584504 18:58719437-58719459 AGAAGGAACCAAAGGAAAGAGGG - Intronic
1158886365 18:61830660-61830682 AGGCTGAACTAAAGGAAAGAGGG + Intronic
1159272556 18:66171124-66171146 AGTCTGAACTACAGAGAAGAGGG + Intergenic
1159339406 18:67116329-67116351 AGGCAGGAAGAAAGGAAAGAAGG - Intergenic
1159516597 18:69466816-69466838 AGGAAGAAAGAAAGGAAAGAAGG + Intronic
1159693700 18:71525942-71525964 AGGAGGAAAAAAAGGAAAGATGG + Intergenic
1159987301 18:74858177-74858199 AGGCAGGAAAAAAGGAAAGAAGG - Intronic
1160049231 18:75416523-75416545 AGAGTAAACAAAAGGAAAGAAGG - Intronic
1162497530 19:11031728-11031750 AGGCTGATCAACAGAAAAGACGG - Intronic
1163487553 19:17597369-17597391 AGGGTGAGGAAAAGGAAAGAAGG - Intergenic
1163488390 19:17602978-17603000 AGGCTGGACTGGAGGAGAGACGG + Exonic
1166352003 19:42203676-42203698 AGGCTCAATGCAAGGAAAGAGGG + Intronic
1166647553 19:44543415-44543437 TGGCTGAAGTAAAGGGAAGAAGG - Intergenic
1168248514 19:55126962-55126984 AGGCTGAGGAACAGGAAAGAAGG - Intergenic
1168380126 19:55913241-55913263 AGGCTGAACTACTGGAGACATGG - Exonic
925680025 2:6410771-6410793 AAGATAAACTAAAGGAAGGAGGG - Intergenic
930233045 2:48861854-48861876 ATGCTGAGCTAAAGGTAAAAAGG + Intergenic
930371105 2:50502205-50502227 AGGAAGAAAGAAAGGAAAGAAGG + Intronic
930826908 2:55704261-55704283 AGGAAGAAAGAAAGGAAAGAAGG - Intergenic
931221305 2:60290614-60290636 AGGGGGAACTAAAGGAAGGTGGG + Intergenic
931264657 2:60649925-60649947 AGGCAGAAAAGAAGGAAAGAAGG + Intergenic
933527260 2:83457299-83457321 AGGCTGAAGTAAATTGAAGAAGG + Intergenic
934725089 2:96611374-96611396 TGGCTGAACCATAGGATAGAAGG + Intronic
935532159 2:104247673-104247695 AGGATGAGCAAAGGGAAAGAGGG + Intergenic
935620572 2:105126115-105126137 AGGAGGAACTACAGGAGAGAAGG - Intergenic
935685706 2:105680827-105680849 AGACTGTACTATAGGGAAGAAGG + Intergenic
935978991 2:108608238-108608260 AGGAAAACCTAAAGGAAAGACGG - Intronic
936062501 2:109304590-109304612 AGTCTGAACTTAAAGATAGAGGG - Intronic
936533780 2:113295142-113295164 AGGATGAATTATAGGAATGAAGG + Intergenic
937328908 2:121010343-121010365 AGACAGAACTAAAAGAAAGCAGG + Intergenic
937603470 2:123768502-123768524 AGGAAGAAAGAAAGGAAAGAAGG - Intergenic
939733908 2:145819492-145819514 AGGATGAAATGAAGGAAGGAAGG - Intergenic
940388049 2:153096941-153096963 AGACTGGAATAAATGAAAGAAGG - Intergenic
940672644 2:156689294-156689316 AGGTTGAACTAAATGACTGAAGG + Intergenic
941386718 2:164860951-164860973 AGGAGGTACTAAAGAAAAGAAGG - Intergenic
941567322 2:167125701-167125723 AAGCTGAACAATAGGAAATATGG + Intronic
942683171 2:178500835-178500857 GAGCTGAACTAAAAGGAAGAGGG - Intronic
943857973 2:192823559-192823581 ATGATGAAATAAATGAAAGAGGG + Intergenic
944010776 2:194972311-194972333 AGGCCTAAATAAATGAAAGATGG + Intergenic
944169793 2:196762024-196762046 ATGCTAAATTAAAAGAAAGATGG + Intronic
944273552 2:197809476-197809498 GTTCTGAACTGAAGGAAAGAAGG - Intronic
945132432 2:206587638-206587660 AGGCTGAAATTACTGAAAGATGG - Intronic
945178352 2:207066281-207066303 AGGCTGAACCATAGGCAAGAAGG - Intergenic
945554956 2:211265384-211265406 AGGGTGAGGAAAAGGAAAGAAGG - Intergenic
946536432 2:220634848-220634870 AGTGTGGACTCAAGGAAAGAAGG - Intergenic
947852078 2:233296477-233296499 ATGCTGAGCTAAAGGTAAGGGGG + Intergenic
947963347 2:234258448-234258470 AGGCTGCAGCAAAGGAGAGAGGG + Intergenic
948033137 2:234836091-234836113 AGGGAGAACAAGAGGAAAGAGGG - Intergenic
948282714 2:236760274-236760296 AGGAAGGAATAAAGGAAAGAAGG + Intergenic
948282720 2:236760302-236760324 AGGAAGGAATAAAGGAAAGAAGG + Intergenic
1169081443 20:2799810-2799832 AGAAAGAACAAAAGGAAAGAAGG - Intronic
1169545428 20:6645295-6645317 AGAAAGAAATAAAGGAAAGAAGG - Intergenic
1169904722 20:10590814-10590836 CGGCAGAGCTAAAGGAAAGCTGG - Intronic
1169960166 20:11151214-11151236 AGGTTGAAATGAAGGAAAAACGG - Intergenic
1171391745 20:24805898-24805920 AGGTTGAAATAAAGTAAACAAGG + Intergenic
1173022786 20:39282256-39282278 TGGCTGATCTAGATGAAAGAAGG + Intergenic
1174474642 20:50787746-50787768 AGGCAGAGAGAAAGGAAAGAAGG + Intergenic
1175505546 20:59481840-59481862 AGGCTGATCTACAGGAAGGGCGG - Intergenic
1176716421 21:10354109-10354131 AGGTTGAAATGAAGGAAAAAAGG - Intergenic
1178234413 21:30824660-30824682 AGGCTGAAACAGAGGAAAGGTGG + Intergenic
1178395405 21:32238445-32238467 AGACTGAAGTAAAGAAAAGCTGG - Intergenic
1178608784 21:34062010-34062032 AGGGAGAACCAAAGGAGAGAAGG - Intergenic
1180601915 22:17025836-17025858 AGGTTGAAATGAAGGAAAAAAGG + Intergenic
1181421961 22:22807273-22807295 AAACAGAACTAAAGGAAAGCAGG + Intronic
1181718245 22:24751157-24751179 AGACTGAAAGAAGGGAAAGAAGG + Intronic
1182819302 22:33201373-33201395 AGGAAGAAAGAAAGGAAAGAAGG + Intronic
1183065407 22:35359415-35359437 AGGCTGAACCAAAGCAAATCGGG - Intergenic
1185104770 22:48861310-48861332 AGGCTGAATTAAAGGAAGGCCGG + Intergenic
949194888 3:1293256-1293278 AGGAAGAAATAAAGGAAAAAAGG - Intronic
949214887 3:1554371-1554393 AAGATGAAATGAAGGAAAGAGGG - Intergenic
950309687 3:11946183-11946205 GGGCTGAACAAAAGGAACCAGGG + Intergenic
951059853 3:18192719-18192741 AGGATGAAAGAATGGAAAGATGG - Intronic
951509190 3:23482585-23482607 CTGATGGACTAAAGGAAAGAAGG + Intronic
953603277 3:44388776-44388798 AGGGAGTACTCAAGGAAAGATGG - Intronic
954556274 3:51519939-51519961 ATGCTGAGGTAAAGGACAGAAGG - Intergenic
955132038 3:56179687-56179709 AGCCTGAACAACAGGAAAAATGG + Intronic
956837032 3:73103922-73103944 AGGCTGGAGGAAAGGAGAGATGG - Intergenic
957696734 3:83649500-83649522 AGGCTGAAGAACAGCAAAGATGG + Intergenic
958885393 3:99721006-99721028 CAGGTGAACCAAAGGAAAGAAGG + Intronic
959080278 3:101793578-101793600 AGGCAGAAAAAAAGGAAAAAGGG - Intronic
961711369 3:128830967-128830989 AGGGTGAGGAAAAGGAAAGAAGG + Intergenic
961725642 3:128927311-128927333 AGGCAGAAGGAAAGGAAGGAAGG + Intronic
961975920 3:131025174-131025196 AGTTTGAACTGAAGCAAAGACGG + Exonic
961998063 3:131267703-131267725 AGGTTGAAATGAAGGAAAAAAGG - Intronic
962076905 3:132091471-132091493 ATGCTGAACTGTAGGAAACATGG + Intronic
962293975 3:134163603-134163625 ATGCTGCACTAAAAGAAAAAAGG - Intronic
962616559 3:137132236-137132258 AGGTTGAACTAAAAGAAAAAGGG - Intergenic
962656135 3:137545399-137545421 AGGTTGAAATGAAGGAAAAAAGG + Intergenic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
965155010 3:165040209-165040231 AGGAAGAAATGAAGGAAAGAAGG + Intronic
966836091 3:184050556-184050578 AGAAAGAAATAAAGGAAAGAAGG - Intergenic
966927877 3:184657337-184657359 AGGCTGAATTAAAGCTATGATGG - Intronic
967335137 3:188336397-188336419 TGGCTCAACTCCAGGAAAGAAGG + Intronic
967596526 3:191331043-191331065 AGGCTGAGCGATAGGAAAGGCGG + Intronic
968468944 4:768374-768396 AGGTTGACAGAAAGGAAAGAAGG - Exonic
969926514 4:10590777-10590799 ACGTTCAACTAGAGGAAAGAAGG - Intronic
970289900 4:14560851-14560873 AGGAAGAAAGAAAGGAAAGAAGG + Intergenic
970297296 4:14643962-14643984 AGGCTGAGCCAGAGGAATGATGG + Intergenic
970861827 4:20713120-20713142 AGGATGTACTAAAGGTAAAAAGG + Intronic
971048207 4:22829851-22829873 AGGCTGAAGTGGAGAAAAGAAGG - Intergenic
971070923 4:23090229-23090251 AGCATGAAGTAATGGAAAGAAGG + Intergenic
971164905 4:24172827-24172849 GGGCTGATGTAAAGGAAACACGG - Intergenic
971596827 4:28540241-28540263 AGGAAGAAAGAAAGGAAAGAAGG - Intergenic
971785735 4:31099965-31099987 ATGCTGAACAGAAGGAAAGAAGG + Intronic
971918491 4:32906452-32906474 AGGCTGAACAGAAGGAACAATGG + Intergenic
972164447 4:36265476-36265498 AGGAAGGAATAAAGGAAAGAAGG - Intergenic
972733301 4:41815924-41815946 AGGCTGAAGGAATGGAAGGAAGG + Intergenic
973993745 4:56436249-56436271 AGGCAGAACTCTAGAAAAGAGGG - Exonic
974985976 4:69026532-69026554 AGGCTGAGAAACAGGAAAGACGG + Intronic
975655582 4:76638117-76638139 AGGATGAACGAAAGCAGAGATGG - Intronic
975883389 4:78938064-78938086 TGGCAGGACAAAAGGAAAGAAGG + Intronic
976115036 4:81716941-81716963 AGGTTGAAATGAAGGAAAAAAGG + Intronic
976195761 4:82529940-82529962 AGGCTGAAAGTATGGAAAGAGGG + Intronic
976565102 4:86543997-86544019 AGACTGAAGAAAAGCAAAGAAGG + Intronic
976839486 4:89414528-89414550 AGTCTGAAAAATAGGAAAGAAGG + Intergenic
977341717 4:95766492-95766514 AGACAGGAATAAAGGAAAGAAGG + Intergenic
977418065 4:96760921-96760943 GAGCAGAACTAAAGGAAATAAGG - Intergenic
977508924 4:97937724-97937746 AGGCTGAAGAACAGCAAAGATGG + Intronic
980603318 4:135055393-135055415 AGGAAGAACGAAAGGAAGGAAGG - Intergenic
981028796 4:140102885-140102907 AGTAGGAAGTAAAGGAAAGAAGG + Intronic
981245415 4:142531283-142531305 AGGAAGAAAGAAAGGAAAGAAGG + Intronic
981277714 4:142921430-142921452 AGGAAGAAATAAAGGAATGAAGG + Intergenic
982083701 4:151814217-151814239 AGGGTGAAGAACAGGAAAGAAGG + Intergenic
982500778 4:156152337-156152359 ATGCTGAAAAAAAGGAAGGAGGG - Intergenic
982663083 4:158229338-158229360 AGGCTGAAGAACAGCAAAGATGG + Intronic
983435973 4:167715829-167715851 AGGGAGAGATAAAGGAAAGAAGG + Intergenic
983972225 4:173889682-173889704 AGGCTGAATGACAGCAAAGATGG + Intergenic
984070413 4:175103759-175103781 AAGCTGAAACAAATGAAAGAGGG - Intergenic
984619924 4:181941021-181941043 AGGCTGAATAACTGGAAAGATGG + Intergenic
984723515 4:182999045-182999067 AGGTTGAAATGAAGGAAAAATGG + Intergenic
984872958 4:184343564-184343586 TGGCTGAACAAAAGGAAATATGG + Intergenic
985314434 4:188640513-188640535 AGGAAGAAAGAAAGGAAAGAAGG - Intergenic
986898760 5:12405281-12405303 ATGGTGAAATAAAAGAAAGATGG - Intergenic
987754113 5:22078239-22078261 AGGAAGAATTAAAGCAAAGAGGG + Intronic
988324207 5:29740616-29740638 AATCTGAACTAAAGGAAATTGGG + Intergenic
989791979 5:45415660-45415682 AGGCTGAATTGAAGGGATGAAGG - Intronic
990144470 5:52743479-52743501 AGGCTGAAGAAAAGGCAAGTCGG + Intergenic
990149081 5:52796854-52796876 AGGCAGCACTAAAGGAAGCAGGG + Intronic
991406526 5:66305712-66305734 AAGCTGAACTGAGGGACAGAGGG + Intergenic
993204693 5:84863874-84863896 AGGCAGGAAGAAAGGAAAGAAGG - Intergenic
993616721 5:90122181-90122203 AGGCTGAAGTAAACGAAAGGAGG + Intergenic
995058659 5:107790105-107790127 AGGATAACCTAAAGCAAAGATGG + Intergenic
997190374 5:131928332-131928354 AGGCAGCACTAAAGGAAAAAGGG - Intronic
997279643 5:132631879-132631901 AGGCTGAAGCCATGGAAAGAAGG - Intronic
997416943 5:133736240-133736262 AGGCAGAACTGATGGTAAGAAGG + Intergenic
998874403 5:146584758-146584780 TGGATGAACAAAAGGAAAAAGGG + Intronic
999504990 5:152185506-152185528 TGGCAGAACAAAAGGACAGAAGG - Intergenic
999645640 5:153714466-153714488 TGGCTGCACTAAAAGAAAGATGG + Intronic
1000031663 5:157406988-157407010 AGGCTGAAAAACAGCAAAGATGG - Intronic
1000192494 5:158924900-158924922 AGGCTAAACTACAGAAAGGAAGG - Intronic
1000535604 5:162474315-162474337 AGCCTTGACTAAAGGGAAGATGG + Intergenic
1001355817 5:171022140-171022162 AGGCTGGAGAACAGGAAAGATGG + Intronic
1001644626 5:173271052-173271074 CGGCCTAACTAAATGAAAGACGG + Intergenic
1001815312 5:174663827-174663849 AAGCTGAAATAAAAGAAGGAAGG - Intergenic
1002433671 5:179218818-179218840 AGGAAGCACTAAAGGAGAGAAGG + Intronic
1003156511 6:3601434-3601456 AGGCAGAAATAAAGGAACAAAGG - Intergenic
1003536682 6:6981664-6981686 TGGGTGAACTAAATGCAAGAGGG + Intergenic
1003934032 6:10957159-10957181 AAGCTGAAAAAGAGGAAAGAAGG + Intronic
1004237472 6:13887078-13887100 AGGCTGAAATAATAGAAAGTGGG - Intergenic
1004297975 6:14431427-14431449 AAGCAGAACTCAAGGAAACACGG + Intergenic
1006216662 6:32449391-32449413 AGGGTGAAAGGAAGGAAAGAAGG + Intergenic
1007230214 6:40343005-40343027 AAACTGAAATAAAGGAAAGAAGG + Intergenic
1007468129 6:42069513-42069535 TGCCTGAACAATAGGAAAGATGG + Intronic
1007762069 6:44139033-44139055 AGGCAGAAGTGAAGGAAGGATGG - Intronic
1007786560 6:44283390-44283412 AGGATGAGATAAAGGAATGAAGG + Intronic
1008068635 6:47076738-47076760 AGGCTGAGCTAAAGGAATACTGG - Intergenic
1008082729 6:47210541-47210563 AGGCTGAAAAACAGCAAAGATGG - Intergenic
1008966815 6:57321119-57321141 AGTCTGAATTAAATGAGAGAAGG + Intronic
1009464633 6:63954197-63954219 AGGGTGAGGAAAAGGAAAGAAGG - Intronic
1009959415 6:70500809-70500831 AGGCTGCACAACAGCAAAGATGG + Intronic
1010295841 6:74194799-74194821 TGCCTGCACTAAAGCAAAGATGG + Intergenic
1011086666 6:83548180-83548202 AGGTTGAAATGAAGGAAAAAAGG + Intergenic
1011698318 6:89932926-89932948 AGCCTGAACTGGAGGACAGAAGG + Intronic
1011944262 6:92881047-92881069 AGGCTGAAGAACAGCAAAGATGG - Intergenic
1013520470 6:110928200-110928222 AGGATGATCAAATGGAAAGAAGG - Intergenic
1013624274 6:111921166-111921188 AGGATGAACAAAAGGACAGATGG - Intergenic
1014662893 6:124194842-124194864 AGGGTGCACTAAAGGATAAAAGG + Intronic
1015395470 6:132729139-132729161 AGACTGAAGGAAAGAAAAGATGG + Intronic
1016714942 6:147214615-147214637 AGGCTCAACTAAGAAAAAGATGG - Intronic
1017279795 6:152610705-152610727 AGGTTGAAATGAAGGAAAAATGG + Intronic
1019776152 7:2913134-2913156 AGGAGGAAGGAAAGGAAAGAGGG + Intronic
1020521582 7:9194980-9195002 AGGCTGCGCTAAAGGAGAGTGGG - Intergenic
1020724707 7:11797385-11797407 AGGCAGAAAGAAAGCAAAGAAGG - Intronic
1020867727 7:13588530-13588552 AGGCTCAAATAAAGGGATGAAGG - Intergenic
1021071836 7:16250434-16250456 AGGTTGAAATGAAGGAAAAAAGG + Intronic
1021112426 7:16710576-16710598 AGAAAGAACTGAAGGAAAGAAGG + Intergenic
1021502668 7:21347602-21347624 AGCCAGAACAAAAGGAAAGTAGG + Intergenic
1021865343 7:24950778-24950800 AGGGTGAAATGAAAGAAAGAGGG + Intronic
1022027912 7:26466041-26466063 TGTCTGAGCAAAAGGAAAGAGGG + Intergenic
1022746856 7:33181234-33181256 AGGTGGAACTAAAGGATAGGTGG + Intronic
1023684751 7:42722895-42722917 AGGCTGAAATAAAAGAAGCATGG + Intergenic
1026315087 7:69220881-69220903 AGGATGAATGAAAGGAAGGAAGG - Intergenic
1026411586 7:70128490-70128512 AGGCCTAAGTAAAGAAAAGAAGG + Intronic
1026989494 7:74575680-74575702 AGGCTGAACTTGGGGAAGGACGG + Intronic
1027990219 7:85349504-85349526 AGGCTGAACAAAGACAAAGAAGG + Intergenic
1028167567 7:87555984-87556006 AAGGAGAAATAAAGGAAAGAAGG + Intronic
1030343864 7:108411064-108411086 AGGCTGAAGTAGTGGAAAGTTGG - Intronic
1030413543 7:109212705-109212727 AGGCTGAAAAACAGCAAAGATGG + Intergenic
1030656928 7:112178784-112178806 AGGATGAACGAGAGGAATGAAGG - Intronic
1030809438 7:113956476-113956498 AGGCTGAAAAACAGCAAAGATGG + Intronic
1030966503 7:115998392-115998414 AGACAGAAATAAAGGAAAGAAGG + Intronic
1031027829 7:116699736-116699758 AGGCTAAAGGAAACGAAAGATGG + Exonic
1031422158 7:121565381-121565403 AGGGTGAGCAACAGGAAAGAAGG + Intergenic
1031723233 7:125204029-125204051 AGACTGAAAAAAAGGAGAGAAGG - Intergenic
1031845901 7:126805757-126805779 AGAATGAAATAAAGCAAAGAGGG - Intronic
1032899666 7:136292968-136292990 TGGCTGGAATAAAGGAAAGGAGG - Intergenic
1033520347 7:142154151-142154173 AGGTTGAACTCAAGGATAGTGGG - Intronic
1033567710 7:142595657-142595679 AGGCAGGAAGAAAGGAAAGAAGG - Intergenic
1033740927 7:144275198-144275220 AGCCTGAACTGAAGGAGGGATGG + Intergenic
1033752979 7:144374415-144374437 AGCCTGAACTGAAGGAGGGATGG - Intronic
1033991219 7:147289481-147289503 AGGAAGAAAGAAAGGAAAGAAGG + Intronic
1035644026 8:1204833-1204855 AGGCTGAACTAAATTACAGATGG + Intergenic
1035796836 8:2365608-2365630 AGGGTGAAGAAAAGGGAAGATGG - Intergenic
1035874654 8:3175412-3175434 GGGATGAAAGAAAGGAAAGAAGG - Intronic
1037264595 8:17044777-17044799 AGGCTGAAATAAGTGAAAGCAGG + Intronic
1037429020 8:18790101-18790123 AGGATGGAAAAAAGGAAAGAAGG + Intronic
1037599617 8:20382978-20383000 AGGCTGAAGCAAAGGAGAGAAGG - Intergenic
1038061758 8:23921952-23921974 AGGCTGAAGTAAACCAAGGAAGG + Intergenic
1038909803 8:31950177-31950199 AGTCTGAACTGAAGACAAGAAGG + Intronic
1038914463 8:32005081-32005103 AGGAAGAAATAAAGGAAAAAGGG + Intronic
1038917151 8:32037275-32037297 AGGCTGCACAACAGCAAAGATGG + Intronic
1039301979 8:36219662-36219684 AAGCTGAAATAAAGGAAAACTGG - Intergenic
1039352992 8:36782425-36782447 AGGAAGAAGTAAAGGAAAGGAGG - Intergenic
1039680675 8:39731765-39731787 AAGGTGAAGTAAAGGAAAGTAGG - Intergenic
1040838252 8:51755122-51755144 AGTCTGAACAAAAGGACAAATGG + Intronic
1041383006 8:57272005-57272027 AGGTTGAAGTGAAGGAAAAAAGG - Intergenic
1042083755 8:65086237-65086259 TGGCTGAACTTAAAGAAATAAGG + Intergenic
1043663855 8:82783087-82783109 AGGAAGAAACAAAGGAAAGAAGG + Intergenic
1044390025 8:91639141-91639163 AGGGTGAAAGGAAGGAAAGAAGG - Intergenic
1044635185 8:94316839-94316861 AGACAGAAATGAAGGAAAGAAGG - Intergenic
1045161450 8:99550613-99550635 AGAATAAACTAAAAGAAAGAGGG - Intronic
1045836547 8:106528103-106528125 AGGGAGAAAGAAAGGAAAGAGGG - Intronic
1045913486 8:107438238-107438260 AGGTAGAAGGAAAGGAAAGAAGG - Intronic
1046212939 8:111102301-111102323 AGGGTAAACAAAATGAAAGAAGG - Intergenic
1047020067 8:120765867-120765889 TGGTTGAACTGAAGGAGAGAAGG + Intronic
1048232846 8:132660594-132660616 ATGATGAATTAAAGGGAAGAGGG - Intronic
1048250951 8:132866529-132866551 AGGAAGAATGAAAGGAAAGAAGG + Intergenic
1048382976 8:133884396-133884418 AGGAAGAAATAAAGGAAGGAAGG + Intergenic
1049505949 8:142998296-142998318 AGACTGAACTAAAGGAAGACGGG - Intergenic
1049868071 8:144951770-144951792 AGCCTGAACTAAAAAAAAAAGGG - Intergenic
1050530507 9:6584714-6584736 AGGCTTAGATAAAGGAATGAAGG - Intronic
1050627790 9:7523910-7523932 AGGGTGAGCTTAAGAAAAGAAGG + Intergenic
1051711604 9:19935916-19935938 AAGCTTCTCTAAAGGAAAGAAGG + Intergenic
1051961836 9:22774998-22775020 AGGCTGAAGTAGAGGCAAAAAGG + Intergenic
1052115656 9:24646184-24646206 AGGCTGGATAACAGGAAAGATGG + Intergenic
1052192079 9:25672860-25672882 AGGGTGAGAAAAAGGAAAGAAGG - Intergenic
1052228476 9:26118425-26118447 AGGCAGGACAAAAGGAACGAAGG + Intergenic
1052466726 9:28839154-28839176 AGGGTGATGAAAAGGAAAGAAGG - Intergenic
1052478082 9:28987527-28987549 AGGCAGAAATAAATGAAATACGG - Intergenic
1052705796 9:31991974-31991996 AGGCTGAAATAAAGGGATGGAGG + Intergenic
1052980054 9:34441551-34441573 AAGCAGACCTAAAGGAGAGAGGG + Intronic
1053276950 9:36790368-36790390 AGGCCTAAGTAAAGGACAGAGGG - Intergenic
1053588037 9:39480628-39480650 AAGCTGAATTAAAAGAAGGAAGG + Intergenic
1055151937 9:73011079-73011101 AGGAAGGAATAAAGGAAAGAAGG - Intronic
1057009964 9:91591861-91591883 AGGAAGAAATGAAGGAAAGAGGG - Intronic
1057179568 9:93022448-93022470 AGGATGACCTATAGGGAAGATGG + Intronic
1058030704 9:100194555-100194577 AGGCTGAAAAAAAGAAAAGAAGG - Intronic
1058726468 9:107809463-107809485 AGGCAGAAATGAAGGAAGGAAGG - Intergenic
1059545114 9:115168039-115168061 TGGCAGAAGGAAAGGAAAGATGG + Intronic
1059574869 9:115477285-115477307 AGGCTGAGGAACAGGAAAGAAGG - Intergenic
1059721588 9:116965223-116965245 AGGTTGGACTAAATCAAAGACGG - Intronic
1061307596 9:129741050-129741072 GGCCTGACCAAAAGGAAAGAGGG + Intronic
1061453702 9:130682279-130682301 AAGCTGGCCTAAAGGAGAGAAGG - Exonic
1061766634 9:132885793-132885815 CGGCTGAACCTAAGGCAAGAAGG - Intronic
1187097687 X:16164859-16164881 AGGAAGAAATGAAGGAAAGAAGG - Intergenic
1187225379 X:17371254-17371276 CAGCAAAACTAAAGGAAAGAGGG + Intergenic
1187729714 X:22239950-22239972 AGGTTGAAATGAAGGAAAAAAGG + Intronic
1187889557 X:23921523-23921545 AAGCTGAACTAAAGGGAAAAAGG - Intronic
1188584231 X:31752755-31752777 AAGCTGAGCTAAGGGGAAGATGG - Intronic
1190070709 X:47276959-47276981 GGTCAGAACCAAAGGAAAGATGG + Intergenic
1190844326 X:54177362-54177384 AGCCTGAACTAAAGCAATGGGGG + Intronic
1191158971 X:57306598-57306620 AGGTTCAACTAAAAGAAAGAAGG - Intronic
1191772299 X:64774458-64774480 AGGTTGAAATAAAGCAAAAAAGG - Intergenic
1191960488 X:66695840-66695862 AAGCTAAACTAAAGCAAATATGG + Intergenic
1191971647 X:66823656-66823678 GTGCTGATCTAAAAGAAAGAAGG + Intergenic
1192321883 X:70096534-70096556 AGGCTGAAGCCAAGAAAAGATGG - Intergenic
1192864089 X:75111657-75111679 AGGCTAAACTAATACAAAGATGG + Intronic
1192937852 X:75880073-75880095 AGGTTGAAATGAAGGAAAAAAGG - Intergenic
1193219695 X:78909857-78909879 AGACAGAAAAAAAGGAAAGAAGG - Intergenic
1193266058 X:79471100-79471122 TGGTGGAAATAAAGGAAAGAAGG - Intergenic
1193289478 X:79754636-79754658 AAAATGAACAAAAGGAAAGAGGG - Intergenic
1193846422 X:86477737-86477759 AAACAGAAATAAAGGAAAGAAGG - Intronic
1194006964 X:88506651-88506673 AGACAGAAATGAAGGAAAGAAGG + Intergenic
1194273461 X:91850082-91850104 ACACTGAACTAAACTAAAGAGGG - Intronic
1194677681 X:96813955-96813977 AGGTTGAAATGAAGGAAAAAAGG - Intronic
1194695722 X:97046980-97047002 AGGCTGAATTCAGGAAAAGATGG + Intronic
1195016807 X:100789030-100789052 AGGGTGAAGAACAGGAAAGAAGG + Intergenic
1195102489 X:101568546-101568568 AGGTTGAAATGAAGGAAAAAAGG + Intergenic
1196607129 X:117670129-117670151 AGGTTGAAATGAAGGAAAAACGG - Intergenic
1197019787 X:121673107-121673129 AGAATAAACTAAAGCAAAGATGG - Intergenic
1197402203 X:126006080-126006102 AGGCTGAAAAACAGTAAAGATGG - Intergenic
1197494331 X:127159141-127159163 AGGTTGTACTGTAGGAAAGAAGG - Intergenic
1197564807 X:128069980-128070002 AAACTGAACCAAAAGAAAGAAGG + Intergenic
1198764935 X:140071010-140071032 AGTCAGAAGTAAAGGAAAGTTGG + Intergenic
1199310918 X:146318374-146318396 AGGCTGCAGAACAGGAAAGATGG - Intergenic
1200813125 Y:7504887-7504909 AGGGTGAGCAACAGGAAAGAAGG - Intergenic
1201458875 Y:14201100-14201122 AGGAAGAAAGAAAGGAAAGAAGG + Intergenic
1201469994 Y:14322591-14322613 AGGTAGAAATAAAGGAAAGAAGG - Intergenic