ID: 1158887317

View in Genome Browser
Species Human (GRCh38)
Location 18:61840511-61840533
Sequence TGATGCAATCAGATAGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158887317_1158887320 15 Left 1158887317 18:61840511-61840533 CCTAGTTCTATCTGATTGCATCA 0: 1
1: 0
2: 0
3: 15
4: 152
Right 1158887320 18:61840549-61840571 GTGCATATGCTTCTAGCTTGTGG 0: 1
1: 0
2: 2
3: 7
4: 91
1158887317_1158887321 27 Left 1158887317 18:61840511-61840533 CCTAGTTCTATCTGATTGCATCA 0: 1
1: 0
2: 0
3: 15
4: 152
Right 1158887321 18:61840561-61840583 CTAGCTTGTGGCTTCATAGATGG 0: 1
1: 0
2: 1
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158887317 Original CRISPR TGATGCAATCAGATAGAACT AGG (reversed) Intronic
909275808 1:73685128-73685150 AGATTCAATCAGAGAGAACTTGG + Intergenic
909357889 1:74730220-74730242 TAATGTAGTCAGATAGTACTGGG - Intronic
910052595 1:82993433-82993455 TGCTGCAAGCAAATAGGACTAGG + Intergenic
912949114 1:114108341-114108363 TGATGCAGTCACATAGTCCTGGG + Intronic
917255692 1:173113735-173113757 TGAGGAAATTAGATAAAACTTGG + Intergenic
923022218 1:230174074-230174096 TGATACATTCAGTTAGCACTTGG - Intronic
1063391162 10:5650668-5650690 TGATGCAGTAAGATAGGACAAGG + Intronic
1064019145 10:11795373-11795395 TCATGAAATCAGATTAAACTTGG + Intergenic
1064232649 10:13543125-13543147 TTATGCATTCAAATTGAACTAGG + Intergenic
1069820803 10:71226583-71226605 GGATGGAATCAGATAATACTTGG + Intronic
1071834173 10:89403119-89403141 TGATGCAGTAAGACAGAAGTGGG - Exonic
1072927562 10:99629796-99629818 TGATGAAATGAGTCAGAACTAGG + Intergenic
1074204914 10:111274745-111274767 TGGTGAAATCAGGAAGAACTGGG + Intergenic
1075420093 10:122294261-122294283 TGATGCTATCAGAGTGACCTGGG - Intronic
1076939075 10:133589691-133589713 TGCTCTAATTAGATAGAACTTGG - Intergenic
1080921222 11:36711306-36711328 TGATCCAATCAGTTACAACTAGG - Intergenic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1083378792 11:62247422-62247444 TGATGAAGTGAGAGAGAACTTGG - Intergenic
1085275034 11:75292940-75292962 GGAGGCAAGCAGATAGAATTGGG - Intronic
1086803401 11:91206824-91206846 TGATGCCAACACATAGAACTTGG + Intergenic
1087813064 11:102629657-102629679 TGCTGCAATAAAATTGAACTTGG + Intergenic
1093607922 12:21116637-21116659 TGGTACAATCAGATATAAATAGG - Intronic
1094070120 12:26403657-26403679 TGATGCAAAGAGACAGAAATAGG + Intronic
1098443689 12:70544783-70544805 TTATGGAATCGGATAGACCTGGG + Intronic
1098731774 12:74044318-74044340 TGATGCAATCTGATATGATTTGG - Intergenic
1099002816 12:77200842-77200864 TTTTGGAATCAGATAGACCTGGG + Intergenic
1102733189 12:115132764-115132786 TGATTAAAGCAGACAGAACTTGG - Intergenic
1108461628 13:50672976-50672998 TGACTGAATCAGAGAGAACTAGG - Intronic
1108726456 13:53188089-53188111 TGATGCTATTAGATAGAAAAAGG + Intergenic
1108988294 13:56622658-56622680 GGATGCAATCTGATGGACCTAGG - Intergenic
1110214445 13:73010702-73010724 TTATACAATCAGATAGATTTGGG - Intronic
1114183871 14:20385817-20385839 TGTTGCCATCAGATAGATCTGGG - Intronic
1115359349 14:32484182-32484204 TGATGCCAGCAGCTAGGACTGGG + Intronic
1118453159 14:65922433-65922455 TAATGAAATCAGATAGATCTGGG + Intergenic
1120258377 14:82149782-82149804 TGTTGCATTCAGATGGATCTAGG + Intergenic
1121282613 14:92710194-92710216 TGATGCAGTCAGGCAGAGCTTGG - Intronic
1121728305 14:96168843-96168865 TGATGCTATCAGCTAAAATTCGG - Intergenic
1121848735 14:97199064-97199086 TGATGTAATTAGACAGAAGTGGG + Intergenic
1126503183 15:49370253-49370275 TGCTGCTAACAGATAGAAATTGG - Intronic
1126578733 15:50222660-50222682 TGAGGCAATCTGACAGAACCAGG - Intronic
1126818904 15:52481986-52482008 TGATTCAGTCAGCAAGAACTTGG + Intronic
1127167078 15:56255265-56255287 TGTTGCAATCATCTAGAACAGGG - Intronic
1130123716 15:81074448-81074470 TGGTCCAATCAGAATGAACTTGG + Intronic
1132040831 15:98523498-98523520 TTTTGAAATCAGATAGACCTGGG - Intergenic
1140717868 16:77743230-77743252 TGTTGCAAGCAGTTAGAAATGGG + Intergenic
1140748063 16:77998640-77998662 TGATGCAAGGAGACAGACCTGGG + Intergenic
1140924370 16:79568348-79568370 TGTTGGAATCAGACAGACCTGGG + Intergenic
1145122396 17:20272249-20272271 TAATGCAAAGAGATAGAAATAGG - Intronic
1146921547 17:36716122-36716144 TGATGCTGTCAGAGAGAGCTTGG + Intergenic
1149442679 17:56688394-56688416 TGTTGCAATCAAGCAGAACTGGG + Intergenic
1150050660 17:61958973-61958995 TGATGGAGTCAGAGAGACCTGGG - Intronic
1151401837 17:73860862-73860884 TGATGGAAACTGCTAGAACTTGG + Intergenic
1154017596 18:10633255-10633277 TGAAGGAATCAGATAGCTCTAGG + Intergenic
1154187269 18:12196343-12196365 TGAAGGAATCAGATAGCTCTAGG - Intergenic
1155069033 18:22296916-22296938 AGTTACAATCAGATAGGACTTGG - Intergenic
1155415571 18:25595660-25595682 TGTTGCCATCTGAGAGAACTGGG + Intergenic
1156254692 18:35383832-35383854 CGCTGCAATCAGATATAGCTGGG + Intergenic
1158887317 18:61840511-61840533 TGATGCAATCAGATAGAACTAGG - Intronic
1159242359 18:65758621-65758643 TTGTGCACTCTGATAGAACTTGG + Intronic
1163608417 19:18288295-18288317 TGATGGAACCAGATTGAACCTGG + Intergenic
1167681488 19:50924947-50924969 AAATGCAATCAGAGAGATCTAGG + Intergenic
928152401 2:28843801-28843823 TTATATATTCAGATAGAACTGGG - Intronic
928455972 2:31422402-31422424 TGATGCAGACAGATTGAAGTGGG - Intergenic
929679003 2:43969494-43969516 TCCTGCAATCAGAAAGAACTGGG + Intronic
937947771 2:127356012-127356034 TGCTGCAATCTCATAAAACTTGG - Intronic
938774666 2:134531009-134531031 TGATACAAGCTGATAGAAGTTGG - Intronic
940402751 2:153266682-153266704 TGATCCAATCACATTGAACTAGG + Intergenic
941823973 2:169871847-169871869 TAATGCAATAAGTTAGAAATAGG + Intronic
943073822 2:183171971-183171993 TGCTACAATCAGACAGAAGTGGG + Intergenic
943867304 2:192942696-192942718 TAATGGAAGCAGAAAGAACTGGG - Intergenic
944582489 2:201144069-201144091 TGATCATATCAGATAGAAATTGG - Intronic
946498964 2:220225398-220225420 CTTTGGAATCAGATAGAACTTGG + Intergenic
948278083 2:236725371-236725393 TGATGAAATCAGATGAATCTTGG - Intergenic
1168913078 20:1465791-1465813 GCTTGCAATCAGACAGAACTGGG + Intronic
1169032956 20:2426508-2426530 TAATGCAATAAGATAAAACAAGG - Intronic
1172113405 20:32560440-32560462 TGTGGCAATCAGGTAGACCTGGG - Intronic
1177091168 21:16770436-16770458 TGATGTCATCATATAGAATTGGG - Intergenic
1178445034 21:32632117-32632139 TGCTGAAATGTGATAGAACTGGG - Intronic
1179901091 21:44395109-44395131 TGATGCCATCAGATAAGACTGGG + Intronic
1180670259 22:17547731-17547753 GGATGCAACCAGAAAGAACAGGG - Intronic
950662628 3:14476097-14476119 TGAAGGAATCAGATAGGCCTTGG + Intronic
958623107 3:96587735-96587757 TCATGTAATCACATAGAAATTGG + Intergenic
959146654 3:102554815-102554837 TGATAGAATTAGTTAGAACTTGG + Intergenic
960165701 3:114398858-114398880 TGATTCAAAGAGATAGAATTTGG - Intronic
962326035 3:134433057-134433079 TGATGCAATCAGACAGAAGGTGG - Intergenic
963968805 3:151405871-151405893 TGAAGCAATTAGAAAGCACTTGG + Intronic
964529105 3:157647932-157647954 TGCTGCATTCAGTTCGAACTTGG - Intronic
965707919 3:171528358-171528380 TGATGCAATCTGACAGAAGTGGG + Intergenic
967389792 3:188944553-188944575 AAATGAAATCAGAAAGAACTGGG - Intergenic
970448007 4:16140043-16140065 TGATGTAATCAGTTAGAATGAGG + Intergenic
971164656 4:24170691-24170713 TGATTCTATGAGATAGAACATGG - Intergenic
974575894 4:63721086-63721108 TGATGCAATCAGAAAGTGCAAGG + Intergenic
976723183 4:88190317-88190339 TGATGAGTTCAGATAGAACAGGG - Intronic
977188355 4:93969088-93969110 TGACACAGTCAGATAGAAATTGG + Intergenic
977349117 4:95857766-95857788 TGAAATAATCAGACAGAACTTGG + Intergenic
978061199 4:104342151-104342173 TAAAGCAATCATATAAAACTTGG - Intergenic
978851690 4:113345139-113345161 TGATGCAATATGAATGAACTTGG + Intronic
979871418 4:125827886-125827908 TTATGCAAGCAATTAGAACTAGG + Intergenic
979885091 4:126017257-126017279 TGTTGCAATCAAATGGAACAAGG - Intergenic
980585090 4:134802766-134802788 TAATGCAAGCAGAAAGACCTGGG + Intergenic
981446803 4:144849499-144849521 TGATGCAAGCAAAAAGACCTAGG + Intergenic
983716009 4:170782274-170782296 TGATGCAAACGTATAGGACTGGG - Intergenic
983746031 4:171201713-171201735 AGATGCAGTCAGATAAGACTTGG - Intergenic
984605212 4:181777834-181777856 TGGTGTAATCAGACAGAACTTGG - Intergenic
988705821 5:33725063-33725085 TGCTGCAGTCAGGGAGAACTTGG - Intronic
991354518 5:65754119-65754141 TGATGAAATCAGTTAGAATGGGG - Intronic
994508755 5:100676246-100676268 TGATGCATTTAGATATGACTGGG - Intergenic
994595538 5:101828489-101828511 TGATTCAATAAGAGAGAACAGGG + Intergenic
995238837 5:109862247-109862269 TGAAGCCATCAGATAAAGCTGGG - Intronic
995561317 5:113384786-113384808 TGAAGCCATCAGACAGAACTGGG + Intronic
995782351 5:115791457-115791479 CTTTGGAATCAGATAGAACTTGG + Intergenic
996585565 5:125084200-125084222 AGATGCAATCAGAGACATCTGGG - Intergenic
997906774 5:137824916-137824938 TTTTGCAATCAGATAGATCTTGG + Intergenic
998251924 5:140559165-140559187 CTCTGCAATCAGAGAGAACTAGG - Intronic
1001228001 5:169962307-169962329 AGGTGCAGTCAGAAAGAACTTGG + Intronic
1004284279 6:14305993-14306015 AAATGCAATCAGATTCAACTGGG + Intergenic
1009425321 6:63507254-63507276 TGATGGAATAAGAAATAACTTGG - Intergenic
1009859771 6:69312217-69312239 AGATGCAATCAAATAGGAATTGG + Intronic
1010066678 6:71690414-71690436 TGATGAAATCAGTTAGATATTGG + Intergenic
1014172335 6:118292274-118292296 GGCTGCAAGCAGGTAGAACTGGG + Intronic
1014725689 6:124969013-124969035 TTATGCCATCAGATAAAGCTGGG - Intronic
1016094534 6:140019842-140019864 TGATGAAATGAGCTAAAACTTGG - Intergenic
1017995938 6:159531684-159531706 CTTTGCAATCAGACAGAACTGGG + Intergenic
1019965352 7:4494275-4494297 TGATGCAATCACCTCCAACTAGG + Intergenic
1021227849 7:18049480-18049502 TTTTGCAATCAGACAAAACTGGG + Intergenic
1021826598 7:24559042-24559064 CTATTCAATCAGAGAGAACTGGG - Intergenic
1022647796 7:32247473-32247495 TGAAGCAATGGGATAAAACTTGG + Intronic
1023529635 7:41138854-41138876 TTTTGAAATCAGATAGATCTGGG - Intergenic
1025812490 7:64883992-64884014 TGCTGCAATCCTATAGAAGTGGG - Intronic
1031070900 7:117160464-117160486 TTTTGCAATCAGATAGATCTGGG - Intronic
1033572300 7:142642471-142642493 TGATTCAATCAGACAGAATTGGG - Intergenic
1033617246 7:143028509-143028531 TGATGAAATCTGACAGACCTAGG - Intergenic
1039158114 8:34585960-34585982 TGCTTCATTCAGATAGAACATGG + Intergenic
1039249496 8:35646426-35646448 AGATGAAATCAGAAAGAAATAGG - Intronic
1039826574 8:41179389-41179411 GTATGCAATTAGCTAGAACTGGG - Intergenic
1043525158 8:81088572-81088594 TGGTGTAATCAGAGAGAGCTGGG + Intronic
1043990078 8:86741965-86741987 TGCTGAATTCAGATAGGACTTGG + Intronic
1045143826 8:99316367-99316389 TGATGCAATCTGGTAGGACCTGG + Intronic
1046961435 8:120117341-120117363 TGAGGGAATGACATAGAACTAGG + Intronic
1047560512 8:125982919-125982941 TGCTGCAATCTCATAAAACTTGG + Intergenic
1048220357 8:132535238-132535260 CTCTGCAATCAGAAAGAACTAGG + Intergenic
1048458035 8:134595864-134595886 TGATGCAACTGGAAAGAACTTGG + Intronic
1048545089 8:135379123-135379145 TGATGCAATCATATTAAGCTTGG - Intergenic
1048963520 8:139598865-139598887 TGATGCAAACAGGTGGAAATAGG + Intergenic
1050746661 9:8884161-8884183 TGAAGGAATCAGATGGAGCTAGG - Intronic
1051245240 9:15103684-15103706 TGATGGATTCAGCTAAAACTCGG - Intergenic
1051879883 9:21829142-21829164 TGATGGCATCAGATACAAATAGG + Intronic
1055223928 9:73970694-73970716 TGCTGAAATCAGTTAAAACTGGG + Intergenic
1056343604 9:85665758-85665780 TGTTGCCATCTGAAAGAACTGGG - Intronic
1056428619 9:86504435-86504457 TGTGGGAATCAGATAGACCTGGG + Intergenic
1057648119 9:96896041-96896063 TGAAGAAAACAGATAGATCTTGG + Intergenic
1059699903 9:116765156-116765178 TGATGCTCTCAGGTAGAATTTGG - Intronic
1060067680 9:120517482-120517504 TGTTGCAATCAGGTAGGATTGGG - Intronic
1060760028 9:126239175-126239197 TTATGCACTCAGATAGGTCTAGG + Intergenic
1202629725 M:6500-6522 TGATGCCAGCAGCTAGGACTGGG - Intergenic
1185965594 X:4597796-4597818 TGATGGGTTCAGAGAGAACTTGG - Intergenic
1194060005 X:89184285-89184307 TGATGAAATCTCATAAAACTTGG - Intergenic
1194088356 X:89556313-89556335 TGATCAAGTCAGATAGAAATTGG + Intergenic
1196103799 X:111874694-111874716 TGGTGTACTCAGATAGACCTGGG - Intronic
1196272534 X:113729350-113729372 TGTTTCAATCAGATAGATTTAGG - Intergenic
1196323792 X:114376906-114376928 TGATGTAATTAGATGCAACTGGG - Intergenic
1198435211 X:136610255-136610277 TGCTGCAATCAGACAAGACTGGG + Intergenic
1198711214 X:139506567-139506589 TTTTGCAATCAGAAAGATCTGGG + Intergenic
1198744963 X:139880516-139880538 TGATGTAATCAGGCAAAACTTGG + Intronic
1198785254 X:140281281-140281303 TGGTGCAATAAGATATAAATGGG - Intergenic
1199807194 X:151311950-151311972 TTTTGGAATCAGATAGATCTAGG + Intergenic
1200441029 Y:3212355-3212377 TGATCAAGTCAGATAGAAATTGG + Intergenic
1200969992 Y:9141897-9141919 TGATGCCAGCAGCTAGGACTGGG - Intergenic