ID: 1158887513

View in Genome Browser
Species Human (GRCh38)
Location 18:61842415-61842437
Sequence CTGCTGTCATTGCTGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 245}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158887506_1158887513 4 Left 1158887506 18:61842388-61842410 CCCAGTGGCCCATTTCTCTTCTG 0: 1
1: 0
2: 1
3: 21
4: 231
Right 1158887513 18:61842415-61842437 CTGCTGTCATTGCTGGAACAAGG 0: 1
1: 0
2: 1
3: 22
4: 245
1158887511_1158887513 -5 Left 1158887511 18:61842397-61842419 CCATTTCTCTTCTGGAGGCTGCT 0: 1
1: 0
2: 4
3: 30
4: 377
Right 1158887513 18:61842415-61842437 CTGCTGTCATTGCTGGAACAAGG 0: 1
1: 0
2: 1
3: 22
4: 245
1158887507_1158887513 3 Left 1158887507 18:61842389-61842411 CCAGTGGCCCATTTCTCTTCTGG 0: 1
1: 0
2: 1
3: 13
4: 224
Right 1158887513 18:61842415-61842437 CTGCTGTCATTGCTGGAACAAGG 0: 1
1: 0
2: 1
3: 22
4: 245
1158887505_1158887513 5 Left 1158887505 18:61842387-61842409 CCCCAGTGGCCCATTTCTCTTCT 0: 1
1: 0
2: 1
3: 37
4: 351
Right 1158887513 18:61842415-61842437 CTGCTGTCATTGCTGGAACAAGG 0: 1
1: 0
2: 1
3: 22
4: 245
1158887510_1158887513 -4 Left 1158887510 18:61842396-61842418 CCCATTTCTCTTCTGGAGGCTGC 0: 1
1: 0
2: 3
3: 26
4: 266
Right 1158887513 18:61842415-61842437 CTGCTGTCATTGCTGGAACAAGG 0: 1
1: 0
2: 1
3: 22
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158887513 Original CRISPR CTGCTGTCATTGCTGGAACA AGG Intronic
900827229 1:4936542-4936564 ATGATGTCAGTGCTGTAACACGG + Intergenic
902457290 1:16544084-16544106 CTGTTCTCATTGCTTGAACCTGG + Intergenic
902494876 1:16863828-16863850 CTGTTCTCATTGCTTGAACCTGG - Intronic
903318270 1:22525816-22525838 CTGGTCTCATGCCTGGAACATGG - Intronic
905043929 1:34981896-34981918 CAGCTGTCACAGCAGGAACATGG - Exonic
905414588 1:37795103-37795125 CTGCTTTCATGGCAGGTACAGGG + Intronic
905649245 1:39645587-39645609 CTGCTGTTTTTCCAGGAACAAGG - Intergenic
905964518 1:42081062-42081084 CTGCTGTCACTGCTGGCATCTGG - Intergenic
907029788 1:51159435-51159457 ATCCTGTCATTGCAGCAACATGG - Intergenic
907549226 1:55289880-55289902 CTGCTGCCACTGCTGGACCCTGG - Intergenic
908430644 1:64053487-64053509 CTTCTGTCATTGCTGGGTCCTGG + Intronic
912638412 1:111320439-111320461 CAGCTGTGATTGCTGCAACTGGG + Exonic
913662276 1:121014974-121014996 CTGTTCTCATTGCTTGAACCCGG + Intergenic
913677556 1:121155845-121155867 CTGCTTTCATTGGTGGCAGATGG - Intergenic
914013653 1:143798159-143798181 CTGTTCTCATTGCTTGAACCCGG + Intergenic
914029390 1:143943474-143943496 CTGCTTTCATTGGTGGCAGATGG - Intergenic
914160059 1:145124476-145124498 CTGCTTTCATTGGTGGCAGATGG + Intergenic
914164173 1:145163028-145163050 CTGTTCTCATTGCTTGAACCCGG - Intergenic
914652277 1:149706768-149706790 CTGTTCTCATTGCTTGAACCCGG + Intergenic
918250610 1:182699854-182699876 GAGCTGGCACTGCTGGAACACGG - Intergenic
918867913 1:189926917-189926939 CTGCTGTCATTTATGGAGGATGG - Intergenic
918983583 1:191595473-191595495 CTGCTTTCATGGCTGGCACTGGG + Intergenic
920464863 1:206174359-206174381 CTGCTTTCATTGGTGGCAGATGG - Intergenic
922607174 1:226896890-226896912 CTCATGTTATTCCTGGAACAGGG - Intergenic
923562636 1:235053124-235053146 TTGCTGTCATTGCAAGAAGAAGG + Intergenic
924145660 1:241072334-241072356 CTGTTTTCCTTTCTGGAACATGG + Intronic
1063666173 10:8061960-8061982 CTGCAGTCCTAGCTGGGACAGGG + Intronic
1064360678 10:14661518-14661540 ATGGTGTCAGTTCTGGAACAAGG - Intronic
1066336097 10:34480061-34480083 CTGCAGTCCTTGCAGGCACAAGG + Intronic
1067049057 10:43001565-43001587 ATGGTGCCATTGCTGGAAGATGG + Intergenic
1068614029 10:59091884-59091906 GTGCTGTTATTGTTGGAGCAAGG + Intergenic
1069728111 10:70594185-70594207 GAGCTGTCATTGCAGGAAGAGGG - Intergenic
1069746174 10:70716410-70716432 CTGCTGCCATCGCGGGTACATGG + Intronic
1070399860 10:76044102-76044124 TGGCTGTCCTTCCTGGAACAAGG + Intronic
1070649900 10:78227864-78227886 CTGCTTTCATAGCTGCAAAATGG + Intergenic
1072717820 10:97763130-97763152 CTGCTGTCTGGGCTGGGACATGG + Intergenic
1072958307 10:99906371-99906393 ATGGTGTCATGGCTGGAACTGGG + Intronic
1073706820 10:105993107-105993129 ATCCTGTCATTGCAGCAACATGG + Intergenic
1074911717 10:117916144-117916166 ATTCTGTCATTGCAGCAACATGG + Intergenic
1074954969 10:118379886-118379908 ATGCTGGCATTGCTGGCCCAAGG + Intergenic
1075299830 10:121312232-121312254 CTGCTGTCACTGCTGGTCCAGGG - Intergenic
1075976553 10:126701156-126701178 CTTCTGTCATTGCTAAGACAGGG + Intergenic
1076115107 10:127890033-127890055 CTGCACTCACTGCTGGAGCATGG - Intronic
1076899548 10:133330837-133330859 CTGCTGTCCTTGCTGGGTTAGGG - Intronic
1077711586 11:4542550-4542572 CATCTGACATGGCTGGAACAAGG + Intergenic
1079010812 11:16826583-16826605 CTGCTGTCATTGCAGGGATATGG - Exonic
1079535653 11:21512090-21512112 TTCCTGTCTTAGCTGGAACATGG + Intronic
1082768520 11:57187435-57187457 CTGCTGCCACCGCTGGAGCAAGG + Exonic
1084203582 11:67577962-67577984 CTTCTGTCCTTGCTAGAGCAGGG - Intergenic
1084573984 11:69976957-69976979 CTGCTGTTAATCCTGGAAGATGG + Intergenic
1085769679 11:79313722-79313744 CTGTTGTCACTGCTGGAGCTCGG - Intronic
1087854385 11:103074165-103074187 CTTCTTTCATTCCTGTAACAAGG - Intronic
1088264354 11:107975308-107975330 GTGATGCCATTGTTGGAACAGGG + Intergenic
1088440040 11:109860126-109860148 TTGCTGTCATTGCAGGAGAATGG - Intergenic
1088890007 11:114036706-114036728 CTGCTGTTTTTGCTGGAGAAGGG + Intergenic
1093588332 12:20869247-20869269 CTGGCGTCACTGCTAGAACAAGG + Intronic
1095455893 12:42385350-42385372 CTGCTCCCATTGTTGCAACAGGG + Intronic
1096125594 12:49117135-49117157 CTACTGCCATTTCTAGAACACGG + Intergenic
1099191897 12:79569741-79569763 AGACTGTCATTGCTGGAACTGGG + Intergenic
1100625433 12:96326716-96326738 CTGCTGACATTGCTGGTCCAGGG + Intronic
1102143808 12:110638790-110638812 CCGGTGTCATTGCTGAATCAGGG + Intronic
1102471949 12:113164178-113164200 CTGCTGTCCCTGCTGGAAGCGGG + Exonic
1106293741 13:28390964-28390986 CTGTGGTCTTTGCTGGACCAGGG - Intronic
1106379648 13:29223880-29223902 CAGCTTTCATGGCTGGCACAGGG - Intronic
1106887832 13:34208950-34208972 CTCCTTTCATTGCTGTCACATGG + Intergenic
1107574425 13:41702430-41702452 CTGCTATCACTGCAGGAAGATGG - Intronic
1107834677 13:44403899-44403921 CTGCCGTCATTGCTGCCCCAGGG - Intergenic
1110305672 13:73984342-73984364 CTGCTCTCCTCGCTGGCACAGGG + Intronic
1112931236 13:104740898-104740920 ATGCTGTGCTTGCTGGGACAGGG + Intergenic
1114198871 14:20504870-20504892 CTGCTGTCCTTGCTGGGTTAGGG - Intergenic
1114686026 14:24532479-24532501 CTTCTGTCATTTTTGGACCAAGG + Intergenic
1116486316 14:45453147-45453169 AGGCTGTCACTGCTGGGACAGGG - Intergenic
1116647169 14:47543201-47543223 CTGCTGTTGTCGCTGGGACAGGG - Intronic
1117070657 14:52053022-52053044 CTGTTGTCATTTCTGGTTCATGG - Intronic
1117648028 14:57872948-57872970 ATGCTGTGATTGGTGGAGCAGGG - Intronic
1118686380 14:68295536-68295558 CTCCTATCTTAGCTGGAACAAGG - Intronic
1119286931 14:73462642-73462664 CTGCTTTCCACGCTGGAACAAGG + Intronic
1120531470 14:85637578-85637600 TTGCTGTCATTGCAGGAGCATGG - Exonic
1120610712 14:86637670-86637692 GTGCTGACATTACTGGGACAAGG + Intergenic
1121958187 14:98233956-98233978 CTTCTGTCATTCCTGGAGAAAGG - Intergenic
1122889386 14:104725385-104725407 CTGCTGCCAATAATGGAACAAGG + Intronic
1124632239 15:31344510-31344532 CTACTGTCATGGCTGGCCCATGG + Intronic
1128469998 15:67943993-67944015 CTGCGGTCCTTGCTGGGCCAGGG - Intergenic
1130142873 15:81245594-81245616 CTGCTGGCATGGGTGGGACAGGG + Intronic
1130220027 15:82011573-82011595 GTGATGCCATTGCTGGAAAAGGG + Intergenic
1131463594 15:92637218-92637240 CTGCTGTGAAGGCTGGAACAGGG + Intronic
1131553688 15:93378744-93378766 CAGCTGTCAGTGATGGAACCAGG - Intergenic
1132312223 15:100865584-100865606 CTGATCTCATAGCTGGTACATGG - Intergenic
1133717969 16:8467394-8467416 CAGCTCTCATTGCTGGCAAATGG + Intergenic
1134033087 16:11008243-11008265 TTGCTGTGATCGCTGGAATATGG + Intronic
1134288796 16:12886586-12886608 CTGCCACCATTGCTGGCACATGG - Intergenic
1137658106 16:50178636-50178658 ATGCTGACACTGCTGTAACATGG + Intronic
1138348089 16:56332129-56332151 CTGCTCTCATGGCAGCAACAGGG + Intronic
1138455958 16:57120905-57120927 CTTCTGTGATTGCTGGGAAAAGG - Intronic
1138716322 16:59027321-59027343 CTTGTGTTATTGCTGAAACATGG - Intergenic
1138918784 16:61501196-61501218 CTGCTGACATAGCTGGATCCCGG - Intergenic
1139336130 16:66232586-66232608 CTGCTGCCATTGCTGATATATGG - Intergenic
1139874734 16:70136562-70136584 CCGATGACATTTCTGGAACATGG - Intronic
1140154652 16:72411172-72411194 CTGTTTGCATTGTTGGAACATGG - Intergenic
1140195274 16:72849942-72849964 CTTTTGTCATCACTGGAACACGG - Intronic
1140361050 16:74344581-74344603 CTGATGACATTTCTGGAACATGG + Intergenic
1140592618 16:76371584-76371606 CTGTTGTCACTTCTGGGACAAGG + Intronic
1144164776 17:12599737-12599759 CTGCTGTCATTTGTGGTAGATGG + Intergenic
1144796368 17:17893980-17894002 CTGCTGTCATCCCTGGAGAATGG - Intronic
1147220773 17:38928801-38928823 CTGCTGTCTTGGCTTGAAGACGG - Intergenic
1147968378 17:44206555-44206577 CTGTTGTCATTTCTGGGAGAGGG - Exonic
1148445592 17:47735082-47735104 CTGTTGTCATTGGTGGACCTGGG + Intronic
1150562870 17:66310018-66310040 CTGCTTTCAGTACTGGAAAAGGG + Intronic
1152992228 18:373966-373988 CTGGAGTCATTTGTGGAACAGGG - Intronic
1153266459 18:3275149-3275171 ATCCTGTCATTGCAGCAACATGG + Intronic
1154100505 18:11468698-11468720 CTGCTTTCCTTCCAGGAACATGG + Intergenic
1154387762 18:13911116-13911138 CTGCGGTGATTGCTAGAGCAAGG + Intronic
1155540094 18:26860874-26860896 CTTCAGACATTGCTGAAACAGGG + Intronic
1158887513 18:61842415-61842437 CTGCTGTCATTGCTGGAACAAGG + Intronic
1160444411 18:78915784-78915806 CTGCAGCCATGGCTGGACCAGGG - Intergenic
1161577894 19:5064931-5064953 CTGCTGTCATTGCCTGCCCATGG + Intronic
1161678619 19:5667547-5667569 CTGCTCTCAGTGCTGGAATGAGG + Intronic
1166863238 19:45821595-45821617 CTGCTTTCAGGGCTGGAACAGGG + Intronic
1167198656 19:48048751-48048773 AAGCTGTTATTGCTGGATCAGGG - Intronic
1202708250 1_KI270713v1_random:40644-40666 CTGTTCTCATTGCTTGAACCTGG + Intergenic
925536193 2:4919659-4919681 CTGATGCCATTGCTAGCACAAGG + Intergenic
926422552 2:12714641-12714663 CAGCTGCCACTGCTGGAACATGG + Intergenic
928606609 2:32948896-32948918 GTGCTGTCATGGCTGGAGTAAGG + Exonic
930865913 2:56121702-56121724 CTGTTGTCAAGGATGGAACAAGG + Intergenic
932307243 2:70712840-70712862 CTTCTGTCCTTGCTGAACCACGG + Intronic
932656973 2:73618761-73618783 CTTCTGTGACTGCTGGAAAATGG + Intergenic
932663637 2:73679012-73679034 CTTCTGTGACTGCTGGAATATGG + Intergenic
932747694 2:74347795-74347817 CTACTGGCAATTCTGGAACAGGG - Intronic
935133756 2:100280464-100280486 CTGCTGTCTATGCTAAAACATGG + Exonic
935836686 2:107062714-107062736 CTGCTGTCATTTCCATAACAAGG - Intergenic
936279533 2:111125187-111125209 CAGCTGTCAATGTTGAAACAGGG - Intronic
936388203 2:112049447-112049469 CTGGTGTCACTGCTAGACCAAGG - Intergenic
937680416 2:124638260-124638282 ATACTGACATTGCTGAAACAAGG - Intronic
937715010 2:125022325-125022347 CAGATGTCAATGCTGAAACACGG + Intergenic
938783196 2:134603749-134603771 TTCCTGTCATTGCTGGTCCAAGG - Intronic
939490956 2:142875697-142875719 ATGCTGTCATTTTTTGAACACGG - Intergenic
942506062 2:176642803-176642825 TGGCTGTTATTGCTGGGACAGGG + Intergenic
943169901 2:184385404-184385426 ATGCCGCCATTGCTGGAAAACGG - Intergenic
945131230 2:206574934-206574956 CTGCTGTAAATGCTGGGACATGG + Intronic
945916286 2:215707905-215707927 CGGCTGTCTCTGCTGCAACATGG + Intergenic
948812993 2:240494523-240494545 AAGCTGTCACTGCTGGGACAGGG - Intronic
1169068643 20:2708317-2708339 CTGCTGGGGTTGCGGGAACAGGG + Intronic
1169163058 20:3398947-3398969 CTGCTGTCATAGCTAATACATGG + Intronic
1172325879 20:34034105-34034127 CTGCTGTCATCTCTTGAAGAAGG + Intronic
1172561669 20:35894249-35894271 CTTATGTTATTTCTGGAACATGG - Intronic
1173434665 20:43021937-43021959 CTTCTGTCCTGGCTGGAACAGGG - Intronic
1175033137 20:55974738-55974760 CTGAGGGCATTGCTGGGACATGG - Intergenic
1175968698 20:62673134-62673156 CTGCTGTGACTGCTGGGCCAGGG + Intronic
1181274653 22:21680956-21680978 GAGCTGTCAGGGCTGGAACATGG + Intronic
1183021605 22:35031505-35031527 CTGCTGGCATTGCTGGGAGGAGG - Intergenic
1183022098 22:35035442-35035464 CTGCAGACATTCCTGGAGCAGGG - Intergenic
1183686351 22:39363375-39363397 CTGCTGTCATTGCCTGGAGAGGG + Intronic
1184352229 22:43951972-43951994 CTGCTGTCATCTCTGGAATCTGG + Intronic
949332047 3:2933423-2933445 CTTCTGTCATTGTGGGAACCTGG + Intronic
950654589 3:14428740-14428762 CTGGTGACATTGCTTGACCAAGG - Intronic
953279199 3:41536299-41536321 CTGCTTTCATTGCTGGGCCTTGG + Intronic
953962486 3:47277601-47277623 CTGGGGTCATTGGTGGAAAATGG - Intronic
956512616 3:70010945-70010967 CTGCTGTCAAGGTTGGAACCAGG - Intergenic
956528975 3:70196336-70196358 CTGTTGTAATTACAGGAACATGG + Intergenic
957196208 3:77071690-77071712 CTGCTGTCTTTGCTGTTCCAGGG + Intronic
960970022 3:123132763-123132785 CTGCTGTCACGGCTGGGACAGGG - Intronic
963373300 3:144430003-144430025 CTGCTGTCATCACTGGGACTTGG + Intergenic
964058278 3:152488662-152488684 CTTCTGTCATTTCTGGCACAAGG + Intergenic
964329795 3:155589775-155589797 CTGCTGTCATTGCTAAAAAGAGG - Intronic
965096679 3:164237583-164237605 CTACTTTCATTGCTGGATCCAGG + Intergenic
966296350 3:178427876-178427898 CTGCTGGCTTTGCTGGCACCTGG - Intronic
967121417 3:186385774-186385796 CTGCTTTCATTCATGGCACAAGG - Intergenic
968264867 3:197355156-197355178 CTGCTGTCATTTCAGGAATATGG + Intergenic
969038263 4:4273552-4273574 CTGCTGTCATTTGAGGAGCACGG - Intronic
969175378 4:5394990-5395012 CTGCACTCCTTTCTGGAACATGG + Intronic
973330578 4:48907001-48907023 CGGCTGTGATTGCTGGAGGAAGG - Intergenic
973587497 4:52408254-52408276 CTGCTGTCATCACTCTAACATGG + Intergenic
973632740 4:52834679-52834701 CTGCAGTCAGTGGTGGAACTGGG + Intergenic
975432362 4:74309082-74309104 GTGCTGTCATTGCTGTATTAAGG - Exonic
976101988 4:81574478-81574500 CTGCTGTTACTGCTGGACCCTGG - Intronic
976846775 4:89497666-89497688 CTGCTGGCATGGTTGGATCATGG + Intergenic
979724363 4:123942637-123942659 CTGCCTTCATTGCAGGAAAAAGG - Intergenic
986446447 5:7825510-7825532 CAGCTGGCATGGCTGCAACAAGG - Intronic
987908674 5:24113129-24113151 CTGCTGGCACTTCTGGAACCTGG + Intronic
988035418 5:25822210-25822232 ATGCTTACATTGATGGAACATGG - Intergenic
989361799 5:40610048-40610070 ATGTTATCATTGCTGTAACAGGG + Intergenic
990631560 5:57675887-57675909 CTTCTGTCATTGCAGGGACAAGG - Intergenic
990739283 5:58895745-58895767 CCACTGTCATTGGTGGAACTTGG - Intergenic
992874636 5:81041587-81041609 TGTCTGTCTTTGCTGGAACATGG + Intronic
993121554 5:83780604-83780626 CTGCTGTCATAGATGTAAAATGG - Intergenic
993670484 5:90754920-90754942 TTGCTGTCAATGCTGTTACAAGG - Intronic
993810365 5:92468542-92468564 CTGCTGTCATTGCAGGTAATAGG + Intergenic
994061917 5:95487353-95487375 ATGCTGCCATTCCTGGAACCTGG + Intronic
995012773 5:107276413-107276435 CTGTTGTCATTGCTAGGACTTGG - Intergenic
995220128 5:109639403-109639425 ATCATGTCTTTGCTGGAACATGG + Intergenic
995400555 5:111736183-111736205 CTCCTGTCATTACTTGAAGATGG - Intronic
996326243 5:122277738-122277760 CTGCTATCATTGATGGAAGCTGG - Intergenic
998216597 5:140242306-140242328 CTGGTGTCATTGCTATTACAGGG - Intronic
998416721 5:141951556-141951578 CTGCTGTCCTTGCTGCATCAGGG - Exonic
1001929661 5:175663969-175663991 CTCCTGGCATTGCTGTCACACGG - Intronic
1003682492 6:8269698-8269720 CTGCTGTCATTGCTGGGAAAAGG + Intergenic
1005512081 6:26520635-26520657 CTCCAGTTTTTGCTGGAACAAGG - Intergenic
1006340099 6:33442193-33442215 CTGCTCTAAGTGCTGGATCATGG - Intronic
1006896117 6:37472172-37472194 CTGTTGTCAGTGCTGCTACAAGG - Intronic
1007221571 6:40283001-40283023 CTGCTCTCATTGCTGTGACAAGG + Intergenic
1007376643 6:41461437-41461459 CTGATGTCCTTGCTTGAAGAAGG - Intergenic
1009003966 6:57758339-57758361 CTACTCTCATTGGTGGACCAAGG + Intergenic
1015138398 6:129900840-129900862 CTGCAGACATTGCAGGAACATGG + Intergenic
1015601082 6:134911328-134911350 ATGCTGTCATTGCAAGATCATGG - Intergenic
1017680880 6:156862630-156862652 CTGCAGTGATTGATGGTACAAGG + Intronic
1017820801 6:158047954-158047976 CTCCTGTCTTTGTGGGAACAGGG + Intronic
1018686754 6:166309337-166309359 CTGCTGTGACTGTTGGCACAGGG - Intergenic
1018919099 6:168158655-168158677 CTCCTATCATTGCCGGAGCATGG + Intergenic
1019864008 7:3687855-3687877 CTGTCGTCATTGCAGGAACCTGG + Intronic
1020832462 7:13109530-13109552 CTGCTTCCATTGCTGGCACCAGG + Intergenic
1020887680 7:13839251-13839273 GTCCTGTCATTACTGGAAAATGG - Intergenic
1023097289 7:36673896-36673918 CTGATTCCATTGCTGGGACATGG - Intronic
1024088071 7:45913334-45913356 GTGGTGTCATTTCTGAAACAAGG - Intronic
1024094772 7:45974806-45974828 CTGCTGTCATTCCCAGAACCAGG - Intergenic
1024248739 7:47490528-47490550 CTGCTGTGAGTGGTGGAATATGG + Intronic
1028177412 7:87674334-87674356 CTGCTATCATGGCAGGAGCAGGG + Intronic
1028582791 7:92424515-92424537 GTGCTGTCAGTGCAGGAACTGGG + Intergenic
1028796677 7:94910355-94910377 CTGCAGTCATTGCCAAAACAAGG + Exonic
1029265195 7:99333386-99333408 CACCTGTCATGCCTGGAACAGGG + Exonic
1030084632 7:105805968-105805990 ATGCTGAGCTTGCTGGAACAAGG + Intronic
1031520647 7:122761284-122761306 CTCCACTCATTCCTGGAACATGG + Intronic
1032456292 7:132075722-132075744 CTGCTGTCTCTGCAGGAACAGGG + Intergenic
1033661358 7:143405299-143405321 CATCTGTCACTGCTGGAACTGGG - Intronic
1034685908 7:152971301-152971323 CTGCTGTATTTGCTGGTCCAAGG + Intergenic
1035376749 7:158411521-158411543 CTGCTGTCGTCCCGGGAACAGGG + Intronic
1036697884 8:10990596-10990618 TTGCTGTTATTGCTGAGACAGGG + Intronic
1037802004 8:22040997-22041019 CTGGTGGCATGGCTGGGACAAGG - Intergenic
1039688435 8:39834951-39834973 CTGGTGTCCTTGCAAGAACAAGG - Intronic
1039913556 8:41843496-41843518 CTGCTGTATGTGCTGGACCAGGG - Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1042462233 8:69083093-69083115 CTGCTGTCTTTACTGGCAGAAGG + Intergenic
1043088598 8:75869516-75869538 CTGCTGTCATCCCTGTAAGACGG - Intergenic
1045499905 8:102737281-102737303 GTGGTGTCATTGCTGGAAGGGGG - Intergenic
1046561547 8:115843880-115843902 CTGCTCTCAGTGGTGGAACATGG - Intergenic
1046640536 8:116725117-116725139 ATCCTGTCATTGCTACAACATGG + Intronic
1047768509 8:128010888-128010910 CTGCTGTGATTTCTGCAGCATGG + Intergenic
1049026317 8:139991813-139991835 CTGCTCTCTTTGCTGAAAAAGGG - Intronic
1049323076 8:142007592-142007614 CAGCTGTCTTTGCTGGCACCAGG - Intergenic
1051463340 9:17348836-17348858 CTGCTTTCATTGACGGAGCATGG + Intronic
1051741682 9:20258513-20258535 CTGCTGTCTCTTCTGGAACCAGG + Intergenic
1051803306 9:20961756-20961778 CTCCTGTCCCTGCTGGACCACGG + Intronic
1056105998 9:83346855-83346877 ATGCTGACATTGCTGGCCCAGGG + Intronic
1056658373 9:88527051-88527073 CTGCTGCCAATGCTGGAGCAGGG + Intergenic
1057115789 9:92520244-92520266 CTGCTGTCCAGGCTGGAATACGG - Intronic
1057833827 9:98428227-98428249 CTCCTGCCATTGCTGGTCCATGG - Intronic
1057977438 9:99621109-99621131 ATCCTGTCGTTCCTGGAACATGG + Intergenic
1058944529 9:109843723-109843745 CTGATTTGATTTCTGGAACAAGG + Intronic
1059461585 9:114434223-114434245 CTGCTGTCATCTATGAAACACGG - Intronic
1060677442 9:125528292-125528314 CAGCTTCCATGGCTGGAACATGG + Intronic
1062183960 9:135206507-135206529 CTGGTGTCACTGCTAGACCAAGG + Intergenic
1062369148 9:136228081-136228103 CTCCTGGCATTTCTGTAACAGGG + Intronic
1187178749 X:16922168-16922190 ATCCTGTCATTGCAGCAACATGG + Intergenic
1187525480 X:20050270-20050292 CTGCTGCCATTGCTGGTCCATGG + Intronic
1187566501 X:20454718-20454740 ATGCTGTTGTTGCTGGACCATGG + Intergenic
1187715387 X:22097448-22097470 CTGCTGTCAGAGCAGGAAGAAGG + Intronic
1187715672 X:22100191-22100213 CTGCTGACATTCCTGGTCCATGG - Intronic
1188552088 X:31375539-31375561 TAGCTGTCATTGCTTGAACACGG - Intronic
1189088569 X:38053211-38053233 ATGCTGATACTGCTGGAACAAGG + Intronic
1189840630 X:45072618-45072640 CTGCTCTAACTGCTGGAGCAGGG + Intronic
1189910510 X:45806130-45806152 CAGCTGTCACTGCTGTAAAATGG + Intergenic
1192288126 X:69760587-69760609 CTGATATCCTTGCTGGAATAAGG - Intronic
1192292917 X:69815999-69816021 CTGCTGTCTTTGCTGTTTCATGG + Intronic
1193392797 X:80948969-80948991 CTGCTGGCAGTGGTGGTACAGGG + Intergenic
1194283114 X:91977254-91977276 CTCTTGTCATTGCTGTAGCATGG + Intronic
1197077975 X:122375756-122375778 CTGGCGTCACTGCTAGAACAAGG + Intergenic
1197795185 X:130290715-130290737 CTCCTGTCAGCGCTGTAACATGG - Intergenic
1198494762 X:137180907-137180929 CAGCTTTAACTGCTGGAACATGG - Intergenic
1198936036 X:141903606-141903628 CTGCTGTCAGCCCTGGAAAAAGG + Intergenic
1200600695 Y:5201788-5201810 CTCTTGTCATTGCTGTAGCATGG + Intronic