ID: 1158888893

View in Genome Browser
Species Human (GRCh38)
Location 18:61855030-61855052
Sequence TTAAATAAGCTAATGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 283}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158888889_1158888893 -8 Left 1158888889 18:61855015-61855037 CCTAAATATTATATTTTAAATAA 0: 1
1: 3
2: 48
3: 330
4: 2603
Right 1158888893 18:61855030-61855052 TTAAATAAGCTAATGGTGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158888893 Original CRISPR TTAAATAAGCTAATGGTGGT GGG Intronic
903112231 1:21145940-21145962 TTTAATTAGCTGATTGTGGTGGG + Intronic
903526711 1:23996230-23996252 TTAAATAATAGAATGGGGGTTGG - Intergenic
903888118 1:26552970-26552992 TTACATAAGGAAATGGGGGTAGG - Intronic
904420558 1:30388325-30388347 TTTCACAAGCTAATGTTGGTTGG - Intergenic
905001550 1:34674649-34674671 TTAAATAAGATATTTGGGGTTGG + Intergenic
905109485 1:35584920-35584942 TGAAATAAGCTAATGATGCAAGG - Intronic
906149267 1:43578144-43578166 TTCAAGAGGCTAATGGAGGTTGG - Intronic
906897932 1:49799896-49799918 TAAAGAAAGCTAATGGTGGAAGG - Intronic
907611763 1:55878284-55878306 TTAAATAAGCATTTGGTGTTAGG - Intergenic
908084566 1:60617107-60617129 TGAATTAAGGCAATGGTGGTAGG - Intergenic
908198993 1:61774534-61774556 GTGAAGAATCTAATGGTGGTAGG - Intronic
909266273 1:73561935-73561957 TTCAATAAATAAATGGTGGTTGG + Intergenic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
910150535 1:84137790-84137812 GTAAATAAGTTGATGGTGGATGG + Intronic
912155459 1:106913479-106913501 TTAAATAAATTCATGGTGATAGG - Intergenic
913665433 1:121043963-121043985 TTAAGTAACCTCATGGGGGTGGG - Intergenic
914016830 1:143827234-143827256 TTAAGTAACCTCATGGGGGTGGG - Intergenic
914160956 1:145133777-145133799 TTAAGTAACCTCATGGGGGTGGG + Intergenic
914655440 1:149735775-149735797 TTAAGTAACCTCATGGGGGTGGG - Intergenic
917374650 1:174336701-174336723 TTAAATGAGCTAATATAGGTAGG - Intronic
917662777 1:177193821-177193843 TTAAAAAGGCTATTGGTGTTAGG + Intronic
919395792 1:197046043-197046065 TTCAGTAAGATATTGGTGGTGGG - Intronic
920777617 1:208955263-208955285 TTCATTAAGCAAATGGTGGTGGG + Intergenic
920837662 1:209526620-209526642 TTACATTAGCTAATACTGGTAGG - Intergenic
921132826 1:212234399-212234421 TTAAAGAAGCTAATGGTCCCAGG + Intergenic
921345389 1:214178661-214178683 TTCAATAAGATAATTGTGGCAGG + Intergenic
921730289 1:218570512-218570534 TGAAATAGGGAAATGGTGGTGGG - Intergenic
921808677 1:219486532-219486554 TTAAAGAAGTTTATGGTGTTGGG - Intergenic
923434197 1:233953187-233953209 TCAAATAAGCTAATAATGATAGG + Intronic
1063128190 10:3153827-3153849 TTAAAAAAGCTAATTGGGCTGGG - Intronic
1065313746 10:24441670-24441692 TTAAATTAGATCAGGGTGGTGGG - Intronic
1065414914 10:25473813-25473835 TGAAATAAGGTCAGGGTGGTTGG - Intronic
1066180034 10:32952780-32952802 TTAATTAAGTTGATTGTGGTTGG - Intronic
1068227856 10:54129945-54129967 AGAAATATGCAAATGGTGGTGGG + Intronic
1071376890 10:85015132-85015154 TTAAATAAGGTCATGAGGGTGGG + Intergenic
1076121152 10:127937560-127937582 TAAAATAAGCTACTTGTGGCTGG + Intronic
1077645474 11:3919750-3919772 TTAAAAAATCGAATGGTTGTTGG - Intronic
1080820675 11:35803252-35803274 TTAAATAAACTAAGGGTGTTAGG - Intronic
1081892280 11:46553237-46553259 TTAAAAAAGTGAATGGTGGCCGG - Intronic
1084880324 11:72166498-72166520 TTAAAAAAGCAAATTATGGTAGG + Intergenic
1085991582 11:81853137-81853159 TTAACTAAGCCAAAGATGGTGGG + Intergenic
1086934924 11:92734532-92734554 TTAAATGAGATAATGTCGGTTGG + Intronic
1089471947 11:118728430-118728452 ATTGATAAGCTACTGGTGGTTGG + Intergenic
1092106879 12:5927589-5927611 TTAAATGAGGAAATGGTCGTTGG - Intronic
1092162945 12:6326008-6326030 TTAAATAAGGTAATGTAGGCCGG + Intronic
1093523796 12:20082708-20082730 TTAAATAAGTTAATGTACGTAGG - Intergenic
1095870682 12:47024259-47024281 TTATATAAGCTATTGTTTGTAGG + Intergenic
1095894174 12:47263822-47263844 AAAAATAAGCTAATGGTAGAAGG + Intergenic
1097331292 12:58335171-58335193 ATTGATAAGCTACTGGTGGTTGG + Intergenic
1097585867 12:61515679-61515701 TTTAAAATCCTAATGGTGGTGGG - Intergenic
1098032030 12:66265127-66265149 TTAAATAAGGTCATTGGGGTGGG + Intergenic
1098233288 12:68394761-68394783 ATATATAAGCTGATGATGGTAGG + Intergenic
1099983860 12:89640213-89640235 TTAAAAAAAATAATGGGGGTGGG - Intronic
1101119658 12:101565688-101565710 TTAAAGAAGCTAAAGTTGGCCGG + Intergenic
1102041703 12:109805235-109805257 TTAACTCAGCAAATGGTTGTTGG - Intronic
1103813212 12:123632648-123632670 TTGAAAAAGCTACTGGTGGCCGG + Intronic
1103909487 12:124344513-124344535 CAAACTAAGCTAATGGTGGATGG + Intronic
1104183594 12:126406426-126406448 TTAAATAAGCTAAAGAAGGCAGG + Intergenic
1104219249 12:126766358-126766380 TAAAACAAGCTAATGATGGGAGG + Intergenic
1107074690 13:36310550-36310572 TTAACTAGGCCAAAGGTGGTGGG - Intronic
1108286058 13:48909026-48909048 TTATATAAGCAAATGGTAGTTGG + Intergenic
1108648752 13:52455395-52455417 TTGAATAAGCCAATGGGCGTAGG - Intergenic
1109297937 13:60557543-60557565 TTAAATGTGATAATGGTGTTTGG + Intronic
1109481571 13:62962577-62962599 TTAAATATTCTAATCATGGTAGG + Intergenic
1110220167 13:73063652-73063674 TTTAATAAGGTAATGGGGGAGGG + Intronic
1110574705 13:77042144-77042166 TCAAATAAGCTTATTGAGGTTGG + Intergenic
1111948439 13:94690157-94690179 TTAAATAAACAAATATTGGTTGG + Intergenic
1112338237 13:98532058-98532080 TTAACTAAGCTGATGGGGGGTGG - Intronic
1114285786 14:21241755-21241777 TTAAATGAGCTAATGATTCTTGG - Intronic
1114432037 14:22670037-22670059 TTAAATGAGGTCATGGGGGTGGG + Intergenic
1116643739 14:47499600-47499622 GTATATAAGCTGATAGTGGTAGG - Intronic
1117341421 14:54795484-54795506 TTAAATAAGATATTGGGGGAGGG - Intergenic
1117563904 14:56974110-56974132 TTCAATAATATAATGCTGGTAGG - Intergenic
1118078563 14:62330022-62330044 TTAAATATGGTAATGGAGGCGGG - Intergenic
1118674418 14:68167848-68167870 TTAAATAAGATAATGTTTATGGG - Intronic
1118876531 14:69789600-69789622 TGAAATTAGATAATGGTGATAGG + Intronic
1119119370 14:72059704-72059726 TTAGATTAGCTCATGATGGTGGG + Intronic
1119518113 14:75264446-75264468 TTAATTATGCTAATGTTGCTTGG - Intronic
1123815857 15:23978146-23978168 TCAAAAAAGCTGATGGTGTTTGG - Intergenic
1124241243 15:28029826-28029848 CTAATTAAGGTATTGGTGGTAGG - Intronic
1124932330 15:34133321-34133343 CTATACAAGATAATGGTGGTTGG + Intergenic
1124933005 15:34141931-34141953 TTAAAAAAGTTAATGATGATTGG + Exonic
1126169001 15:45678809-45678831 TTAAAAAAGCTAAAGCTGGAGGG - Intronic
1130415163 15:83686893-83686915 TAAAATAAGCTAAAAGGGGTGGG + Intronic
1131375712 15:91921288-91921310 TTAAATGAGCTAATATGGGTGGG - Intronic
1133013342 16:2927017-2927039 ATTGATAAGCTAATGGCGGTTGG - Intronic
1136098737 16:27977787-27977809 CAAAATAATCTCATGGTGGTGGG - Intronic
1138138839 16:54548901-54548923 TCAAATCAGCAAATGGTGATGGG - Intergenic
1138827952 16:60343674-60343696 TGAGATAAGCAAAGGGTGGTAGG + Intergenic
1138895699 16:61201330-61201352 TTAAATTTGCTTTTGGTGGTTGG - Intergenic
1139256014 16:65543575-65543597 TTAAATAAACTAAAGCTGTTAGG - Intergenic
1140553361 16:75892357-75892379 GGAAACAAGCTCATGGTGGTAGG - Intergenic
1144000184 17:11046739-11046761 TGAAATTAGATAATGGTGATAGG + Intergenic
1144286735 17:13784545-13784567 TATAATAAGCTGATTGTGGTTGG + Intergenic
1146012481 17:29206993-29207015 TTATATAACCAAATGGTGGGGGG + Intergenic
1146898565 17:36564763-36564785 TTAAAAAAGCTATGGGGGGTGGG - Intronic
1150452319 17:65279204-65279226 TTAAAGAATCTGATGGTGGCTGG - Intergenic
1154991099 18:21599490-21599512 TTAAAAAAGCCAATGCTGGTGGG + Intronic
1156113569 18:33758452-33758474 TTAAATAAGGTCATAATGGTGGG + Intergenic
1156261844 18:35451733-35451755 TTAACTAGGCTAAAGGAGGTGGG + Intronic
1156591883 18:38499351-38499373 TTAAATAAACTACTGGTAGTAGG - Intergenic
1156631286 18:38972471-38972493 TCAAATAAACTAATTGTAGTTGG - Intergenic
1158837035 18:61341616-61341638 TTCAATGAGGTAATGATGGTTGG - Intronic
1158888893 18:61855030-61855052 TTAAATAAGCTAATGGTGGTGGG + Intronic
1159456798 18:68669467-68669489 TTAAATGTGGTAATGGTGGGAGG + Intergenic
1159461480 18:68726563-68726585 TTAAACAAGCTAAAGGTGACTGG + Intronic
1162249530 19:9430617-9430639 TTAAGTAAGCCAAAGGTGATGGG - Intronic
1162765074 19:12914321-12914343 TGAAATTGGCTAATGGTGGGAGG - Intronic
1164035234 19:21448492-21448514 TTAACTAAACTAAAGGTGTTTGG - Intronic
1164812685 19:31170355-31170377 TTAGATAAGGTAATGAGGGTAGG - Intergenic
1167034404 19:46985624-46985646 ATAAACAAGCAAATGGTGGATGG + Intronic
1167758483 19:51427958-51427980 TTATATAAGCTGATGGGGCTGGG - Intergenic
1168405839 19:56110063-56110085 TTAAAAAAGCAAATGTTGGCCGG + Intronic
1168420733 19:56201367-56201389 TTAAATAAGATTATGTTGGCCGG - Intergenic
926571919 2:14538308-14538330 TTAAATAAGCAAATAGAGGGAGG - Intergenic
928315429 2:30240779-30240801 TAAAATAAGCTACTGCCGGTGGG - Intronic
928331803 2:30363391-30363413 TAAAATAAGGTAATTGAGGTTGG + Intergenic
930383766 2:50665369-50665391 TGAAATAAGTTAATTCTGGTTGG - Intronic
930431486 2:51282339-51282361 TTTAGAAAGCTAATTGTGGTAGG - Intergenic
931994382 2:67825643-67825665 TTAAATAAGCCAATGTTGTTTGG - Intergenic
933340610 2:81021183-81021205 TTCAATAAACAAATGGTGCTTGG - Intergenic
933949205 2:87313883-87313905 TTAAATGAGGTCATGGGGGTGGG - Intergenic
934510763 2:94940073-94940095 TTAAATAAGGTCATAGGGGTGGG + Intergenic
936330992 2:111547714-111547736 TTAAATGAGGTCATGGGGGTGGG + Intergenic
937638335 2:124183023-124183045 ATAAATAAGCAAAAGGTGGAGGG - Intronic
937672889 2:124557746-124557768 TTAAATAACATGATGGTGGCAGG + Intronic
937794741 2:126003313-126003335 TTAAAGAAGCTAATGCTATTGGG - Intergenic
938413886 2:131088395-131088417 TTCAATAAGGCAATGGTGGGGGG + Intronic
938956445 2:136303074-136303096 TTAAATAAGCTGATCGGTGTAGG - Intergenic
939043766 2:137224589-137224611 TTAAATAAGCTAATACTTGTAGG + Intronic
939718644 2:145617775-145617797 TTAAAAAAGCCAATGATGGAAGG - Intergenic
944270166 2:197774070-197774092 TTAAATAGCCTAATGGTGAGTGG - Exonic
945257107 2:207811982-207812004 ACAAATAAGCTAATGGAGCTGGG - Intergenic
945819878 2:214650945-214650967 ATAAATTAGCTAAAGCTGGTTGG + Intergenic
945878155 2:215299723-215299745 TTAAATGAGGTCATGGGGGTGGG - Intergenic
946667774 2:222068699-222068721 TTAAATGAGATAATAGAGGTAGG - Intergenic
946916226 2:224524961-224524983 AATAATAAGCTAATGGGGGTGGG + Intronic
947327809 2:228997082-228997104 TTAAATAACCTAGTGGAGTTAGG + Intronic
947403410 2:229750880-229750902 TTAAATAAGCTGATTTAGGTAGG - Intergenic
948303574 2:236929102-236929124 TTAATTAATTAAATGGTGGTTGG + Intergenic
1169705428 20:8498389-8498411 TAAAATAACATAAAGGTGGTCGG - Intronic
1170477673 20:16732058-16732080 ATAAATAAGTGAATGGTGGGGGG + Intronic
1170884366 20:20327065-20327087 TTAAAAAAGATATTGGTAGTTGG + Intronic
1173121606 20:40294906-40294928 TCAAATGAGTCAATGGTGGTAGG - Intergenic
1173711454 20:45159749-45159771 TTTAATACTGTAATGGTGGTGGG + Intergenic
1174182237 20:48682137-48682159 TTTAATAAGGGAAAGGTGGTAGG - Intronic
1175694541 20:61091632-61091654 TTAAGAAAGCTATGGGTGGTTGG - Intergenic
1177246152 21:18526999-18527021 TTAAATAAGCAAATGATTGGAGG - Intergenic
1177494073 21:21866207-21866229 TTAAATAAGATCATGAAGGTTGG - Intergenic
1178124601 21:29503264-29503286 TAAAATAAGCTAATGGAAGGAGG - Intronic
1179050086 21:37881725-37881747 TTAGATAAGGTAATGAAGGTGGG - Intronic
1179321887 21:40300204-40300226 TGATATAAGCTAATGATGGAAGG - Intronic
1179419139 21:41222185-41222207 TGAAATAAGCTAATGGATATAGG + Intronic
1184575637 22:45363217-45363239 TCAAATAAGCCAGTGGTGGGAGG - Intronic
950030927 3:9852858-9852880 ATTGATAAGCTACTGGTGGTTGG + Intronic
950615729 3:14156443-14156465 TTATATAAGCCAATGGCAGTGGG + Exonic
952316395 3:32236449-32236471 TATGATAAGCTCATGGTGGTTGG - Intergenic
952551446 3:34483217-34483239 AAAAATAAGCCAATGGTTGTAGG - Intergenic
953370049 3:42379856-42379878 TTAGATTAGCTCATGGGGGTAGG + Intergenic
953503060 3:43456667-43456689 TTAAATAAGTGAAAGGTGGAAGG + Intronic
954737847 3:52721582-52721604 TTTAATTAGCTAAGTGTGGTGGG + Intronic
959469950 3:106738041-106738063 TTAGATAAGCTCATGAGGGTGGG - Intergenic
960080752 3:113537655-113537677 TGAGATTAGCCAATGGTGGTCGG - Intronic
964770420 3:160219130-160219152 AGAAATAAGCTTATGGTGGTAGG - Intergenic
964854504 3:161131727-161131749 TTTAATATGCAAATGGTAGTGGG - Intronic
965077331 3:163995655-163995677 TCAAAGAAGCTAATGGGGCTGGG - Intergenic
965329559 3:167353810-167353832 TCATACAAGCTAATAGTGGTGGG + Intronic
965828610 3:172756100-172756122 TTAAATGAGATAATAGGGGTGGG - Intronic
966664968 3:182461974-182461996 TTTAATACTATAATGGTGGTGGG - Intergenic
967937833 3:194743166-194743188 TTAAATAAGGTAATGCAAGTAGG - Intergenic
968249864 3:197198973-197198995 TGAAATTAGTTAGTGGTGGTAGG + Intronic
969067405 4:4497515-4497537 TTAAATGAGTTAATGTTTGTAGG - Intronic
969239970 4:5891503-5891525 TTAAATCAGTTAATGCCGGTCGG - Intronic
970311340 4:14785607-14785629 TCAAAGAGGGTAATGGTGGTTGG + Intergenic
970944448 4:21673713-21673735 TTGAACTAGCTAGTGGTGGTGGG + Intronic
973088445 4:46099632-46099654 TTAACTAAGGTGTTGGTGGTGGG - Intronic
973222355 4:47742994-47743016 CTAAATAATTAAATGGTGGTGGG + Intronic
973565772 4:52185745-52185767 TTAAATAAGCTCATCAAGGTTGG + Intergenic
973976048 4:56263604-56263626 TTAAATAAGCTAAGTAGGGTGGG - Intronic
976238224 4:82923971-82923993 TTAAATAAGCATATAGTGGCCGG + Intronic
977165202 4:93686349-93686371 GTAAAGAAGCTAGTGGTGATGGG - Intronic
981016857 4:139982826-139982848 TTAAATAAGTAGATGGTGGGAGG - Intronic
981118749 4:141023091-141023113 TTAAATAAGCTAATAAAGGAAGG - Intronic
982185904 4:152798345-152798367 TTAAATAATTTAATGGTTGTAGG + Intronic
982890040 4:160835857-160835879 TTAAACAGGCTCATGGTGATTGG + Intergenic
983215339 4:164997395-164997417 ATTGATAAGCTACTGGTGGTTGG - Intergenic
983873241 4:172846232-172846254 TTAAATAGGCTTCTGGTAGTTGG - Intronic
985062841 4:186095434-186095456 TTCAATATGTTAATGGTGGAGGG - Intergenic
986364657 5:7018677-7018699 TTTAATAAGCTACTTGAGGTGGG + Intergenic
987330191 5:16850249-16850271 ATAAATAAGCAACTGGAGGTTGG - Intronic
987479681 5:18437787-18437809 TTAAATTAGCTCATGGGGGTGGG + Intergenic
988246095 5:28683690-28683712 TTAAATAAGGTTATGAAGGTGGG + Intergenic
988814570 5:34821328-34821350 TTAACTACAGTAATGGTGGTAGG + Intronic
989774160 5:45182773-45182795 TTAAATAAGGTAATGATAATTGG - Intergenic
990220355 5:53581625-53581647 TTAAATAGGCAAAGGGTGTTGGG - Intronic
990798161 5:59567735-59567757 TTAAGTAAGCAAATGATGGATGG + Intronic
992925136 5:81575523-81575545 AAAAACAAGCTAATGGTGGGAGG + Intronic
993574415 5:89583834-89583856 TTAAATAAGGTCATAATGGTAGG - Intergenic
995887572 5:116913394-116913416 TTAAAAAAACAAATGGTGGCCGG - Intergenic
995888526 5:116923004-116923026 TTAAATAAGGTAGAGTTGGTTGG + Intergenic
996298875 5:121958271-121958293 TTAAATAAGGTCATAATGGTAGG + Intergenic
996664781 5:126046477-126046499 TTAAACAACCTAATGTTCGTTGG + Intergenic
997044481 5:130297869-130297891 TAAAATTAGCTATTGGTGGTAGG - Intergenic
998529595 5:142872336-142872358 TTTAATAAGATATGGGTGGTGGG - Intronic
998662040 5:144249517-144249539 TTTAATAAGTTAACGGGGGTAGG + Intronic
999124140 5:149234239-149234261 AGAAATAAGCTAAAGGAGGTGGG + Intronic
1000028944 5:157384959-157384981 AAAAAGCAGCTAATGGTGGTTGG + Intronic
1000201215 5:159012832-159012854 TTAAATAAGGTCATTGGGGTGGG + Intronic
1000425264 5:161082845-161082867 TTAAAAAAACTCATGGTGGTGGG + Intergenic
1000869525 5:166558493-166558515 TGAAAAAATCTAATGGTGGTGGG + Intergenic
1001017184 5:168152158-168152180 TTAAATGAGCTAATGCATGTAGG + Intronic
1001152054 5:169239180-169239202 TTGAATAAGCTAAATTTGGTTGG + Intronic
1002556905 5:180049041-180049063 TTAAATAAGCAGAGGCTGGTAGG + Intronic
1004777066 6:18859540-18859562 TTAAATAGGGTGATGGAGGTAGG + Intergenic
1004783599 6:18940363-18940385 TTAAATAAACTTGTGCTGGTTGG + Intergenic
1005333574 6:24771739-24771761 TTCAATAAGGCAAAGGTGGTGGG - Intergenic
1005584331 6:27260963-27260985 TTAATTACGCTAAAGGTCGTGGG + Intergenic
1006018289 6:31100626-31100648 TATAATAATTTAATGGTGGTAGG - Intergenic
1009187638 6:60592448-60592470 TTAAAAAAGCAAATGGTTGCGGG + Intergenic
1009354074 6:62718463-62718485 TTAAATATGAAAATGTTGGTAGG - Intergenic
1009655151 6:66534602-66534624 TTAAATAAGCTACTGAGAGTGGG + Intergenic
1009751805 6:67885549-67885571 ATAAATAGGCTAATGGTTGCAGG + Intergenic
1010007908 6:71015490-71015512 TTAACTGAGCTGATGGAGGTAGG + Intergenic
1010153738 6:72767246-72767268 TGAAATCAGTTAATGGTGTTAGG + Intronic
1010899824 6:81412825-81412847 TTAGATAAGGTAATCATGGTGGG - Intergenic
1011074078 6:83419264-83419286 TTAAAAAAACAAAAGGTGGTGGG + Intronic
1011456897 6:87560600-87560622 TTAAATATGCAAATGATGGCAGG + Intronic
1012324257 6:97895380-97895402 TTTAATAAGCAAATGGAAGTGGG - Intergenic
1013929382 6:115512848-115512870 TTAAATAATAAAATGGTGGAAGG - Intergenic
1014397909 6:120949322-120949344 TCAAATAAGCTAATGTGGCTGGG - Intergenic
1014419045 6:121218315-121218337 TAAATTAAGCTAAAGGAGGTGGG + Intronic
1015340155 6:132089854-132089876 TTAAATAAACTCATGATGATGGG + Intergenic
1016533533 6:145085532-145085554 GTAAATAAAATGATGGTGGTCGG + Intergenic
1016943567 6:149506180-149506202 TTAAATAAGAAAATGGAGGCTGG + Intronic
1017293590 6:152769294-152769316 TTATTCAAGCTAATGGTGGACGG - Intergenic
1017553925 6:155542608-155542630 TGAAATAAGCCACTGGTTGTGGG + Intergenic
1018876070 6:167824311-167824333 GTCAATAAACTAATGTTGGTTGG + Intergenic
1020529482 7:9313208-9313230 TTTAATACTATAATGGTGGTGGG + Intergenic
1020697472 7:11431948-11431970 TTAAAGAAATTAATGTTGGTAGG - Intronic
1022060968 7:26794669-26794691 TTTTACAATCTAATGGTGGTGGG - Intronic
1022426280 7:30271839-30271861 TTAAAGAATCTGATGCTGGTTGG + Intergenic
1028307754 7:89287533-89287555 TTAAATAAACTAATGGTTAACGG + Intronic
1029166027 7:98591681-98591703 TTAAATCAGCAAATGATGGTGGG - Intergenic
1031914516 7:127550312-127550334 TTGCATAAGCTAATTTTGGTGGG - Intergenic
1034585412 7:152087260-152087282 TTAAATAGGGTAATCTTGGTAGG + Intronic
1035199452 7:157251559-157251581 TGAAATGAGCTAATGGAAGTAGG + Intronic
1037851324 8:22331831-22331853 TTAAATGAGGTCATGGGGGTGGG - Intronic
1038937873 8:32272342-32272364 TTAAATAAGCACATGAGGGTTGG - Intronic
1039285603 8:36037282-36037304 TTAAATAAACTAATTAGGGTAGG + Intergenic
1041058858 8:54016540-54016562 ATGAATAAGCAAATCGTGGTTGG + Intronic
1041119131 8:54568894-54568916 TTAAATAACTTATTGTTGGTTGG - Intergenic
1041607464 8:59799597-59799619 CAAAATATGCTAATGGTGGAGGG - Intergenic
1041744731 8:61196464-61196486 TTAATTAAGCCAATATTGGTTGG - Intronic
1042564281 8:70097025-70097047 TTAAAGAACCTACTGGGGGTGGG - Intergenic
1042790971 8:72605757-72605779 ATAAATATTCTAATGGTGGCAGG + Intronic
1043683427 8:83060118-83060140 TTGAATGAAATAATGGTGGTTGG - Intergenic
1043927691 8:86056722-86056744 TCAAATAAGCTAATAGATGTAGG - Intronic
1044176530 8:89131066-89131088 TTAACTAAGCCAAAGGTGATGGG + Intergenic
1045227193 8:100260564-100260586 TTAAAAAGGCAAATGTTGGTTGG - Intronic
1045235478 8:100349406-100349428 TTAAATAAGGCAGTGGGGGTGGG - Intronic
1045444545 8:102246960-102246982 TGAAATAAGGCAGTGGTGGTGGG + Intergenic
1045573529 8:103394420-103394442 TAAAATATGCTTATGGTGGAAGG - Intergenic
1049121415 8:140741840-140741862 TTAAAAAAACTAATGGAGGCTGG + Intronic
1049597310 8:143490616-143490638 TTAAATAAGATACTGATGGCCGG + Intronic
1050605443 9:7296571-7296593 TGAGGTAAGATAATGGTGGTAGG + Intergenic
1051072126 9:13183248-13183270 TTCATTTAGCTAATGTTGGTTGG - Intronic
1051317805 9:15861779-15861801 TTTATTACTCTAATGGTGGTGGG - Intronic
1051534022 9:18136807-18136829 TTAAATATGCCAATGGTTGCTGG - Intergenic
1051853160 9:21532448-21532470 TTAAATAAGCTCATAAGGGTGGG + Intergenic
1051873088 9:21761839-21761861 TTAAAAGAGATAATGATGGTGGG + Intergenic
1053021878 9:34700929-34700951 TTAGATAATCCAATGGGGGTGGG + Intergenic
1053709366 9:40789937-40789959 TTAAATATTCTAAAAGTGGTCGG - Intergenic
1054419274 9:64910740-64910762 TTAAATATTCTAAAAGTGGTCGG - Intergenic
1055674027 9:78636624-78636646 TTAAATGAGGTAATAGGGGTGGG + Intergenic
1055733597 9:79304628-79304650 TTAAAAAATATAATGGTGGCCGG - Intergenic
1057289879 9:93798768-93798790 TTAAATAAGGTCATGAGGGTGGG + Intergenic
1058504033 9:105651364-105651386 TTTAATAAATTAATGGTGGATGG + Intergenic
1058919517 9:109599723-109599745 TTAAATAAGATAGTGGTGTATGG + Intergenic
1059385107 9:113958520-113958542 TTAAATGAGCTAGTTGTGCTTGG - Intronic
1060273560 9:122165421-122165443 TTAAATAAGCCAGGCGTGGTGGG + Intronic
1186236758 X:7519903-7519925 TTAAAAAAGGTAATGTTGGCTGG - Intergenic
1188572430 X:31604037-31604059 TCAAATAAGCTGTTGGTGGCAGG - Intronic
1188921733 X:35985901-35985923 TTAAATAAGCTAATGATGGCAGG - Intronic
1190118080 X:47638767-47638789 TTAAAGGAGATAATGGTGGAAGG - Intronic
1192594180 X:72388734-72388756 TTAAATAAGGTCATGGTGAAGGG + Intronic
1192597488 X:72426844-72426866 CTAAATGAGGTAATGGGGGTGGG + Intronic
1193660878 X:84256780-84256802 TTACATAAGCTAATAATGATTGG + Intergenic
1194689607 X:96967566-96967588 AAAAATTAGCTAAGGGTGGTGGG - Intronic
1194694569 X:97030017-97030039 TCAGAGAAGGTAATGGTGGTCGG - Intronic
1195027461 X:100891804-100891826 TTAAAAAAATTAATGGTGTTGGG + Intergenic
1195886484 X:109644334-109644356 TTAAATAAGTTTGTGGTGATTGG - Intronic
1196350950 X:114728585-114728607 CAAAATAAGGTAATGGTGTTAGG - Intronic
1196903679 X:120411114-120411136 TTAAATATTTTAGTGGTGGTGGG - Intergenic
1197119750 X:122876333-122876355 TTAAATAAGATAATGTGTGTTGG - Intergenic
1197444584 X:126535109-126535131 TTACATAAGTTAATGGTAATTGG - Intergenic
1198229272 X:134673996-134674018 TCAAAAAAGCAAAGGGTGGTAGG - Intronic
1198365202 X:135933044-135933066 TTAAATGAAGTAAAGGTGGTGGG - Intergenic
1198651374 X:138867065-138867087 TTAAACAAGATAATGTGGGTGGG + Intronic
1201605631 Y:15781375-15781397 TTAAATAAGCTGATTATGGCAGG - Intergenic