ID: 1158890907

View in Genome Browser
Species Human (GRCh38)
Location 18:61870969-61870991
Sequence TGCCATTATCAGGATGGGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 1, 2: 4, 3: 14, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158890907_1158890918 9 Left 1158890907 18:61870969-61870991 CCGACCCCATCCTGATAATGGCA 0: 1
1: 1
2: 4
3: 14
4: 144
Right 1158890918 18:61871001-61871023 CCTGCACCTGCTTCCCAGAGAGG 0: 1
1: 0
2: 2
3: 48
4: 507

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158890907 Original CRISPR TGCCATTATCAGGATGGGGT CGG (reversed) Intronic
901269503 1:7940984-7941006 TGCCATTATCAGGCAGGGACGGG - Intronic
902730394 1:18365199-18365221 TGCCATTGTAAGGAGGGTGTGGG - Intronic
902809976 1:18882487-18882509 TGCCATTATCGGAGTGAGGTTGG - Intronic
906345906 1:45014209-45014231 TGTCAGTGTCAGGATGGGCTTGG - Intronic
907329597 1:53662446-53662468 TGCCATTATCATGATGATGATGG + Intronic
911344600 1:96681349-96681371 TGCCATGATCAGGCTGGGGTTGG - Intergenic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
913120806 1:115738887-115738909 TGCCAAAAGCAGGATGGGGTGGG - Intronic
915361276 1:155287684-155287706 TGAGAGTATCAGGATGGGGTGGG - Intronic
916075434 1:161197710-161197732 TGCCATGGCCAGGAAGGGGTGGG + Intronic
917394808 1:174581940-174581962 TGCCATTACCACAGTGGGGTAGG + Intronic
919549476 1:198966476-198966498 TGCCACTACCAGGATGGGTAGGG + Intergenic
920089667 1:203443242-203443264 TGCAATGAAGAGGATGGGGTAGG + Intergenic
923060235 1:230465408-230465430 TGCCATTTTGTTGATGGGGTGGG + Intergenic
924454120 1:244204401-244204423 TGCTATTCACAGGCTGGGGTGGG + Intergenic
924782931 1:247169546-247169568 TTCCCTGAGCAGGATGGGGTGGG - Intronic
1063624160 10:7673832-7673854 TGACATTTGCAGGGTGGGGTGGG - Intergenic
1064085304 10:12341465-12341487 TGCCATTATCAGGAGAGGGGAGG - Intergenic
1070379672 10:75869337-75869359 GGCCTGTATCAGGCTGGGGTTGG - Intronic
1073047562 10:100649632-100649654 GGCCATCATCAAGATGGGGTGGG + Intergenic
1074514043 10:114148277-114148299 TGCCATTAGCAGGATGGGGCAGG - Intronic
1075076881 10:119357830-119357852 TGCCATTGGCAGGGTGGGGGTGG + Intronic
1077724562 11:4661334-4661356 TGTCATCATCAGGATTGGGCTGG - Intergenic
1078791830 11:14551261-14551283 TGCCATTATCAGGATGTGATGGG + Intronic
1081069594 11:38595003-38595025 TGCCTTTATCAGGTGGGGGTTGG - Intergenic
1083167414 11:60899256-60899278 TGCCACTATCAGGATTTGGTCGG - Exonic
1088226971 11:107631401-107631423 TGACATTTTCACGATGGGGGGGG - Intronic
1088407205 11:109495166-109495188 TGCAGTAATCAAGATGGGGTAGG + Intergenic
1089649760 11:119905146-119905168 TTCTCTTACCAGGATGGGGTTGG - Intergenic
1091456231 12:610165-610187 TGCACTTGTCAGGATGGGGAAGG - Intronic
1092946340 12:13457612-13457634 TGCTACTATCTGGTTGGGGTTGG + Intergenic
1095508319 12:42922138-42922160 TGACATTCTCAGGATGGAGGAGG - Intergenic
1096868562 12:54579137-54579159 TGCCCTTCTCGGGGTGGGGTAGG - Exonic
1098469213 12:70824725-70824747 TGCCTTTGTCGGGATGGGGTTGG + Intronic
1099109430 12:78538964-78538986 TGTCATTAACAGGATTGGGTTGG + Intergenic
1100569061 12:95829193-95829215 TTTGATTTTCAGGATGGGGTGGG + Intergenic
1100633713 12:96414071-96414093 TGCCATTTCGAAGATGGGGTAGG - Intergenic
1101310224 12:103571587-103571609 GGCCTTTATCAGGCTGAGGTGGG - Intergenic
1101888424 12:108689648-108689670 TGCCTTCCCCAGGATGGGGTGGG - Intronic
1103075744 12:117981186-117981208 TGGCAACATCAGGATGGGGGTGG + Intergenic
1109890732 13:68609606-68609628 TGCCAATATCAGGATATTGTCGG - Intergenic
1111682384 13:91459482-91459504 TACCATTATCAGGATGCCCTGGG - Intronic
1112810910 13:103217448-103217470 TTCAACCATCAGGATGGGGTGGG - Intergenic
1113596399 13:111537159-111537181 TGCCATCCTCAGGATGGAGAAGG - Intergenic
1118839006 14:69497265-69497287 TGACATTTTCCGGCTGGGGTTGG - Intronic
1121403918 14:93706489-93706511 TGTCATTATTATGATGGGTTTGG + Intronic
1123806379 15:23877897-23877919 GGGCATTATCAGGAGGGGTTGGG + Intergenic
1124005845 15:25794899-25794921 TCCCATTATCAGGATGAAGAGGG + Intronic
1126756005 15:51925423-51925445 GGCCATCATCAGAATGGTGTTGG - Intronic
1127281734 15:57498848-57498870 AGCCAGTAGAAGGATGGGGTGGG + Intronic
1128774614 15:70310000-70310022 TGCCTTAATCTGGGTGGGGTGGG + Intergenic
1129799017 15:78399527-78399549 TGCCATCATCAGAAACGGGTTGG + Intergenic
1135670771 16:24373735-24373757 TGGGATTATCAGGATAGGTTGGG + Intergenic
1136618616 16:31413301-31413323 TGCCATCCTGAGGATGGGATGGG + Intronic
1137002417 16:35240928-35240950 TGCCATTATCATGCTGGGAATGG - Intergenic
1138890966 16:61143722-61143744 TCCCATTATCAGGAGGGGGTAGG - Intergenic
1139324736 16:66143706-66143728 TCCCATTATATGGATGGGGAAGG - Intergenic
1146944893 17:36866871-36866893 TGCCATCAGCAGGCTGGGGCTGG - Intergenic
1148208752 17:45795515-45795537 TGCTATAATCAGGAAGGGGGAGG - Intronic
1150540011 17:66088044-66088066 TGCTGGTATCAGCATGGGGTGGG - Intronic
1150600930 17:66650333-66650355 TGATATTATCAGAATGGTGTCGG + Intronic
1151389626 17:73777336-73777358 TGCCAGGGTCAGGATGGGGCAGG - Intergenic
1155026591 18:21946149-21946171 TGCCATTTTCTGGAAGGAGTGGG + Intergenic
1155987182 18:32242608-32242630 GGCCATTATCAGCCTGGGGAGGG + Intronic
1156400000 18:36731576-36731598 TGCCAATAGGAGGATGGGTTAGG - Intronic
1156950140 18:42885933-42885955 TGACATTATCATGAAGGGGCCGG + Intronic
1158890907 18:61870969-61870991 TGCCATTATCAGGATGGGGTCGG - Intronic
1159011200 18:63060216-63060238 TACTATTTTCAGGATGGGGTTGG + Intergenic
1161567705 19:5012748-5012770 GGCCATCAGCAGGATGGGGTTGG + Intronic
1163315622 19:16538741-16538763 TGCCATTATGAGGAAGGAGAGGG - Intronic
1164714167 19:30379495-30379517 CGCCATAAGGAGGATGGGGTGGG + Intronic
924964619 2:64044-64066 TGCCATTATCTGTATGTGGAAGG - Intergenic
926704372 2:15826375-15826397 TGCCATTATTTGGATGGTTTGGG + Intergenic
927460003 2:23290384-23290406 TGCCACTATCAGCATTGTGTTGG - Intergenic
928460374 2:31466806-31466828 TGCCAGGATAAGGATGAGGTAGG + Intergenic
929531555 2:42756144-42756166 AGCCAGTCTCAGGATGGGGGCGG - Exonic
931235055 2:60406075-60406097 TCCCTTTCTCAGGAGGGGGTGGG + Intergenic
931241268 2:60454407-60454429 TGCCGATATGAGGATGGGATTGG - Intronic
932623200 2:73278742-73278764 AGCAATTATGAGGTTGGGGTAGG + Intronic
932848394 2:75157790-75157812 GGCCATTATCAGGAAGATGTGGG + Intronic
935520944 2:104104470-104104492 TGACATTATTAGGATTTGGTCGG + Intergenic
937532084 2:122841755-122841777 TGTAATTATCAGGCTGGAGTTGG - Intergenic
938810655 2:134849800-134849822 TGCCAGGATCTGCATGGGGTGGG + Intronic
939989796 2:148866668-148866690 TGCCATTATCATGATTGTGATGG + Intergenic
946066892 2:216995731-216995753 TGCCCTTTCGAGGATGGGGTTGG - Intergenic
1172175771 20:32970991-32971013 TGCCATGGGCAGCATGGGGTGGG + Intergenic
1172830057 20:37825872-37825894 TGCCATTGTAGCGATGGGGTTGG + Intronic
1173525792 20:43731616-43731638 AGCAATTATCATTATGGGGTGGG + Intergenic
1175274425 20:57758294-57758316 TGGCATTAGCAGGATGTGGATGG + Intergenic
1175564009 20:59958528-59958550 TGCATTTATCAGAGTGGGGTGGG - Exonic
1176105124 20:63382280-63382302 TGTCCTTATCAAGATGGGGGTGG + Intergenic
1183738157 22:39655221-39655243 TGCCATTATTATGATGGGGATGG + Intronic
949225883 3:1695361-1695383 TGCTACTCTCAGAATGGGGTGGG - Intergenic
952291908 3:32025141-32025163 TGCCTTTATCAGAATGAGGAAGG + Intronic
956367107 3:68516180-68516202 TTCCATTATCAAGATGGGTTGGG - Intronic
958091410 3:88881407-88881429 TACCTTTATCAGGAATGGGTGGG - Intergenic
962239945 3:133743915-133743937 TGCCATTCCTTGGATGGGGTAGG - Intergenic
963381040 3:144530690-144530712 TGCCATAATCAAGATGGGCAAGG + Intergenic
963974788 3:151468511-151468533 TGCCATTATCAGGAGGGCTAAGG - Intergenic
964381622 3:156103491-156103513 TGCCATTTTCCAGATGGGGATGG - Intronic
968551598 4:1226292-1226314 TGCAATCATCCGGATGGGGTGGG - Intronic
968811127 4:2800118-2800140 TGACGTGACCAGGATGGGGTCGG + Intronic
969521058 4:7677968-7677990 TGCCAAGAACAGGGTGGGGTGGG + Intronic
969841121 4:9882846-9882868 TACCATCATGAGGTTGGGGTAGG - Intronic
974420578 4:61667999-61668021 TTCAAATATCAGGGTGGGGTGGG - Intronic
974581332 4:63806519-63806541 TGCCAAGATCAGGATTTGGTGGG + Intergenic
975520355 4:75294133-75294155 CTCCATTATCAGGATGATGTTGG + Intergenic
977760709 4:100733335-100733357 AGCCCTTATCAGGATGCTGTGGG - Intronic
980446442 4:132914997-132915019 TACCATCTTGAGGATGGGGTTGG - Intergenic
981163073 4:141522145-141522167 AGCCATTATCAGGATGGGGTGGG + Intergenic
982005546 4:151059460-151059482 TGCCATTACTAAGATGGGGAAGG + Intergenic
982258076 4:153468747-153468769 TGTCAAAATCAGGAGGGGGTGGG - Intronic
983018500 4:162644867-162644889 TGACATTCCCAGGATGGGGGTGG + Intergenic
984213749 4:176882380-176882402 TGGCTTTATGAGGATGTGGTCGG - Intergenic
984270457 4:177542882-177542904 TGGCAGAATTAGGATGGGGTGGG - Intergenic
985547395 5:516550-516572 TGGCAACATCAGGATGGGGCTGG + Intronic
985752578 5:1689467-1689489 TACCAGTATCAGGGTGGGGCAGG + Intergenic
987301738 5:16603664-16603686 TGCCACTCTGAGGGTGGGGTTGG - Intronic
989329040 5:40234170-40234192 GGCCATTAGCAGGATGCTGTGGG - Intergenic
992173776 5:74129408-74129430 GGCCATTATCTGCATGGAGTGGG - Intergenic
994604451 5:101949404-101949426 TGCCATTTTCAGAGTTGGGTAGG + Intergenic
995834860 5:116389876-116389898 TGCCATTTCTAGGAGGGGGTGGG + Intronic
996046623 5:118881772-118881794 TGCCATTCTCATGATGGTGAGGG - Intronic
996504165 5:124250715-124250737 TGCCTTAATTAGGCTGGGGTAGG - Intergenic
1003511618 6:6785938-6785960 TGCCAGTCCCAGGCTGGGGTCGG - Intergenic
1007709219 6:43811270-43811292 TGCCATTCTCTGCATGGGGCTGG - Intergenic
1008032000 6:46707247-46707269 TTCCATCATTAGGCTGGGGTAGG - Intronic
1008594963 6:53032941-53032963 TTCCATCATCTGGAGGGGGTGGG - Intronic
1010132941 6:72516799-72516821 TGACACTGTCAGGATGAGGTTGG + Intergenic
1013827814 6:114235758-114235780 TGCCATTACCTGGAAGGTGTAGG - Intronic
1017026329 6:150184541-150184563 GGCCATGAAGAGGATGGGGTGGG - Intronic
1019234619 6:170599961-170599983 TGCCATTGGCTGCATGGGGTGGG - Intergenic
1026074086 7:67150182-67150204 TGCCATTTTCTGGGTGTGGTAGG + Intronic
1027946650 7:84755387-84755409 GGACATTATCAGAATGGGTTAGG - Intergenic
1028993553 7:97075876-97075898 TTCCATTATCAGGCTGGGTAGGG + Intergenic
1029411475 7:100414734-100414756 TACCATTATCAGGCTGGGCACGG + Intronic
1030014528 7:105205244-105205266 TGACATCATGAGGAAGGGGTGGG + Intronic
1036446874 8:8829208-8829230 TGCCAGACTCAGGATGGGGAAGG - Intronic
1037361372 8:18078168-18078190 TGTCATTATTAGGAAGGGATAGG - Intronic
1039365654 8:36925585-36925607 TGCCCTTATCAGTGTGGGGGTGG + Intronic
1043789711 8:84449005-84449027 TTCCATTATCTGAATGGGATTGG - Intronic
1044896015 8:96891943-96891965 AGAGATTATAAGGATGGGGTTGG + Intronic
1045536046 8:103028957-103028979 TGCCCTAATAAGGATGCGGTGGG + Intronic
1045870213 8:106918049-106918071 TGGCATTTTCAGGATGGGAGGGG + Intergenic
1047321107 8:123783972-123783994 TTCCATTTTTAGGATGGAGTAGG + Intronic
1047957527 8:129986855-129986877 TGCCATTACCAGAAGGGGCTTGG - Intronic
1048217719 8:132511850-132511872 AGCCATAATCAGGATGGGTCTGG + Intergenic
1048220347 8:132535201-132535223 TGCCATGACAAGGGTGGGGTGGG - Intergenic
1048383191 8:133886512-133886534 TGCCATTATCAGGAAGTGGCAGG - Intergenic
1049959343 9:723334-723356 TGACACTATCTGGAAGGGGTGGG + Intronic
1053412752 9:37926196-37926218 TGCCATCCTCAGGGTGGGGGTGG - Intronic
1058682066 9:107448756-107448778 AGCCATGATTGGGATGGGGTTGG - Intergenic
1058694337 9:107546724-107546746 TGCAAATAACAGGATGGAGTGGG - Intergenic
1062100381 9:134724933-134724955 TGCCATCCTCCAGATGGGGTTGG + Intronic
1062145586 9:134988015-134988037 TGCCATTCCCAGGGTGGGGAAGG - Intergenic
1203786010 EBV:127972-127994 TGCCTTTTTCAGGATGGACTTGG - Intergenic
1186603994 X:11069981-11070003 TACCAATAACAGGGTGGGGTGGG + Intergenic
1189317884 X:40068692-40068714 TGGCATTTTGAAGATGGGGTAGG - Intronic
1190915152 X:54806161-54806183 TGCCATGATTTGGAAGGGGTGGG + Intergenic
1195088680 X:101438272-101438294 TCCCATTATCAGGCTGGGTGCGG + Intronic
1198329412 X:135608045-135608067 AGACATTATCAGTTTGGGGTTGG - Intergenic
1198333033 X:135639630-135639652 TGACATTATTAGGTTGTGGTCGG + Intergenic
1198362145 X:135906070-135906092 AGACGTTATCAGGTTGGGGTTGG - Exonic
1199914170 X:152320907-152320929 AGCCTTTATCAGGTTGGAGTTGG - Intronic