ID: 1158892319

View in Genome Browser
Species Human (GRCh38)
Location 18:61884254-61884276
Sequence CCACGTGACCTGAGTGCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 77}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158892319 Original CRISPR CCACGTGACCTGAGTGCACA AGG (reversed) Intronic
900086614 1:901320-901342 CCAGGTGGGCTGAATGCACATGG - Intergenic
906523558 1:46480992-46481014 CTAGGAGACCTGAGTGCATAGGG - Intergenic
908710734 1:67011424-67011446 CCACTTGACCAGATTCCACAGGG - Intronic
909412768 1:75374091-75374113 GCAAGTGACCTGAATGCAGAAGG + Intronic
909572273 1:77128559-77128581 CCAGCTAACCTGAATGCACAAGG + Intronic
910310902 1:85823561-85823583 CCAGGTGACCAGGGTGAACAAGG - Exonic
915777642 1:158507853-158507875 CCACGTGAACTGAAAGTACAAGG - Intergenic
920346908 1:205312008-205312030 TCACCTGAGCTGAGTGCACATGG + Intronic
922023085 1:221723751-221723773 CAATGTGTCCTGATTGCACAAGG - Intronic
924773717 1:247099867-247099889 CCTCGTGATCTGCATGCACAGGG + Intergenic
1063462357 10:6222812-6222834 CCACGTGAGCTCAGGGCACTCGG - Intronic
1066676666 10:37894850-37894872 CCTCATGACCTCAGTGCATATGG + Intergenic
1071021459 10:81061809-81061831 CAAAGTGACCTCACTGCACATGG - Intergenic
1074110259 10:110417734-110417756 TCACGGGGCCTCAGTGCACAAGG + Intergenic
1076338911 10:129729137-129729159 CTTCTTGACCTGAGTGGACAGGG + Intronic
1077197030 11:1286233-1286255 ACACGAGCCCTGAGTGCACAGGG + Intronic
1082813176 11:57491205-57491227 CCAGGTGACCTGCCTGTACAGGG - Exonic
1083884177 11:65563353-65563375 CCAGGTGACCTGAGTCCAGTTGG - Intergenic
1084589724 11:70083747-70083769 CAACCTGACCTCAGTACACAGGG - Intronic
1084643898 11:70443209-70443231 CCACGTGATCTGAGCACACGTGG - Intergenic
1085052426 11:73386762-73386784 CTAGGTGACCTGAGCCCACAGGG - Intronic
1085450289 11:76627877-76627899 TCACGTGGTGTGAGTGCACATGG - Intergenic
1089574547 11:119432148-119432170 CCACCTGCCCTGATTGCCCAAGG - Intergenic
1090954213 11:131500106-131500128 CCACGTGACATCAGTGGCCACGG + Intronic
1091360382 11:134974691-134974713 CCATGTGACCTATGTGGACAGGG + Intergenic
1102415743 12:112761123-112761145 TTACATGACCTGAGTTCACAGGG - Intronic
1104912896 12:132248144-132248166 CACAGGGACCTGAGTGCACAGGG - Intronic
1106340826 13:28824987-28825009 CCACCTGACCAGAGTGCAGCTGG + Intronic
1111353280 13:87062347-87062369 CCACGTGACATCACTGAACATGG - Intergenic
1115152159 14:30298000-30298022 GCACTTGTCATGAGTGCACATGG - Intergenic
1129365469 15:75051407-75051429 CCAGCTGGCCTGAGTCCACAGGG - Intronic
1132615622 16:839963-839985 CCCCCTGACCTGAGTGCCCAGGG - Intergenic
1137776965 16:51063521-51063543 CCACGTCTCCTGAGAGCACCTGG + Intergenic
1140413539 16:74756445-74756467 CCACATGACCTCAGGGCCCAGGG + Intronic
1141535992 16:84680091-84680113 CCTAGTGACTTCAGTGCACAAGG - Intergenic
1141712286 16:85707007-85707029 CCACGTGACCGCAGAGCCCATGG + Intronic
1144399907 17:14886309-14886331 CCTGCTGACCTGAGTGCATAGGG - Intergenic
1145046047 17:19617117-19617139 CCATGTGACTTGAGTTCACAAGG + Intergenic
1146554207 17:33809577-33809599 ACACGTATCCTTAGTGCACATGG + Intronic
1148159074 17:45439832-45439854 CCCAGTGACCTCAGTGCCCACGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151879859 17:76888404-76888426 CCGGGAGACCTGAGTGCACACGG - Intronic
1152279949 17:79379305-79379327 CCCCGAGACCTGAGTCCCCAGGG - Intronic
1152845482 17:82597116-82597138 CCACGTGACCTGTGTCGACACGG - Intronic
1154494752 18:14947316-14947338 CCATGTGACCTATGTGGACAGGG - Intergenic
1158892319 18:61884254-61884276 CCACGTGACCTGAGTGCACAAGG - Intronic
1163826675 19:19528128-19528150 CCAGGTGGCCGGAGGGCACAGGG - Exonic
1165158794 19:33803896-33803918 CCACCTGCCCTGTGTGCACAAGG - Intronic
1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG + Intronic
1166996706 19:46722942-46722964 CCCCGTGCTCTGAGGGCACAGGG + Exonic
925044451 2:761435-761457 CCAAATGTCCTGACTGCACATGG + Intergenic
925127700 2:1472241-1472263 TCACATGATCTGAGTGCTCATGG + Intronic
925817609 2:7768843-7768865 CCAGGGGACCTGAGGGCACAGGG - Intergenic
935235674 2:101136333-101136355 CCATGTGATCTGTGTACACAGGG + Intronic
936350848 2:111711473-111711495 TCACGTGACCTGTGTACCCAAGG + Intergenic
937350168 2:121155615-121155637 CCAGCTGTCCTGTGTGCACAGGG - Intergenic
942226813 2:173823728-173823750 CCTCAGCACCTGAGTGCACAAGG + Intergenic
947044744 2:225968963-225968985 CCACCTGACATCACTGCACATGG - Intergenic
948716691 2:239869802-239869824 CCAAGGGACCTGAGGGCACCGGG + Intergenic
948862406 2:240759051-240759073 CCACGTAACCTGGGAGAACAGGG + Intronic
1170129367 20:13002140-13002162 CCTCAGGACCTGTGTGCACAGGG + Intergenic
1174668018 20:52278415-52278437 CCATGAGACTTGAGGGCACAAGG + Intergenic
1175825333 20:61933748-61933770 CCACGTGCCCCGAGTGCTCAGGG - Intronic
1180599907 22:17008844-17008866 ACACGTGACATAAGTACACACGG - Intergenic
1180814657 22:18781922-18781944 CCACGTGTCCTGAGTGGCAAGGG - Intergenic
1181200846 22:21216258-21216280 CCACGTGTCCTGAGTGGCAAGGG - Intronic
1182321819 22:29482597-29482619 CAAGGTGACCTGATTGCTCACGG + Intronic
1184355457 22:43976674-43976696 CCACGTGCTGTGAGTGCTCATGG + Intronic
1185370279 22:50457701-50457723 CGACGTGGCCTGAAGGCACAGGG + Intronic
955343864 3:58146679-58146701 CCACGTGAGCTGTGGGCAAAGGG - Intronic
955451702 3:59075448-59075470 GCAAGTGACCTCAGTGTACAGGG + Intergenic
968000396 3:195201728-195201750 TCACAGGACCTGAGTGCCCAAGG + Intronic
981014616 4:139960926-139960948 CCAGGTGACTTGAGTTCAAAAGG + Intronic
985695192 5:1336109-1336131 CCAAGTGGCATCAGTGCACATGG + Intronic
988365932 5:30299049-30299071 CCAAGTGCCTTGAGTGCACATGG - Intergenic
997820813 5:137064055-137064077 CACCGTGACCTTAGTGGACAAGG + Intronic
999141229 5:149363707-149363729 CCAAGTGATCTCAGTGCCCAAGG + Intronic
1001340106 5:170835379-170835401 CCAGGTGACGTGTATGCACATGG - Intergenic
1019694787 7:2439225-2439247 CCACGTGACCTGAGGATGCAGGG + Intergenic
1023039699 7:36161347-36161369 CTAAGAGACCTGAGAGCACAGGG + Intronic
1037829228 8:22178166-22178188 CCAGGTGCCCTGGGTGCACACGG - Intronic
1043173978 8:77000615-77000637 CCTCGGGGCCTGTGTGCACAGGG + Intronic
1057030201 9:91769453-91769475 CCACATGCCCTGCGTGCTCAGGG - Intronic
1058424328 9:104863375-104863397 CCACATGAACTGAGCCCACATGG + Intronic
1060762383 9:126266864-126266886 CCTCGGGATCTGTGTGCACATGG - Intergenic
1061958782 9:133977505-133977527 CCACGTGTCCCCGGTGCACAAGG - Intronic
1062234520 9:135501429-135501451 CCAAGTGACCTGGGGGCACTGGG + Intronic
1191062953 X:56318641-56318663 ACATGGGACCTGAGTTCACAGGG - Intergenic
1192147800 X:68693633-68693655 CCACTTGAGCTGAGTGGACTCGG + Intronic
1197769762 X:130082569-130082591 CCACGTGCCCTCAGCGCTCACGG + Intronic