ID: 1158893592

View in Genome Browser
Species Human (GRCh38)
Location 18:61894323-61894345
Sequence GGGCCGGGTGCTGGGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158893592_1158893606 8 Left 1158893592 18:61894323-61894345 CCTGCAGCCCCAGCACCCGGCCC No data
Right 1158893606 18:61894354-61894376 GGGCGGCACCCCCACCTGCCCGG No data
1158893592_1158893614 27 Left 1158893592 18:61894323-61894345 CCTGCAGCCCCAGCACCCGGCCC No data
Right 1158893614 18:61894373-61894395 CCGGCCGCCCTCCGCGTTCGCGG No data
1158893592_1158893599 -9 Left 1158893592 18:61894323-61894345 CCTGCAGCCCCAGCACCCGGCCC No data
Right 1158893599 18:61894337-61894359 ACCCGGCCCGGCCCTTCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158893592 Original CRISPR GGGCCGGGTGCTGGGGCTGC AGG (reversed) Intergenic
No off target data available for this crispr