ID: 1158893595

View in Genome Browser
Species Human (GRCh38)
Location 18:61894331-61894353
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158893595_1158893614 19 Left 1158893595 18:61894331-61894353 CCCAGCACCCGGCCCGGCCCTTC No data
Right 1158893614 18:61894373-61894395 CCGGCCGCCCTCCGCGTTCGCGG No data
1158893595_1158893606 0 Left 1158893595 18:61894331-61894353 CCCAGCACCCGGCCCGGCCCTTC No data
Right 1158893606 18:61894354-61894376 GGGCGGCACCCCCACCTGCCCGG No data
1158893595_1158893616 23 Left 1158893595 18:61894331-61894353 CCCAGCACCCGGCCCGGCCCTTC No data
Right 1158893616 18:61894377-61894399 CCGCCCTCCGCGTTCGCGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158893595 Original CRISPR GAAGGGCCGGGCCGGGTGCT GGG (reversed) Intergenic