ID: 1158893596

View in Genome Browser
Species Human (GRCh38)
Location 18:61894332-61894354
Sequence CGAAGGGCCGGGCCGGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158893596_1158893606 -1 Left 1158893596 18:61894332-61894354 CCAGCACCCGGCCCGGCCCTTCG No data
Right 1158893606 18:61894354-61894376 GGGCGGCACCCCCACCTGCCCGG No data
1158893596_1158893614 18 Left 1158893596 18:61894332-61894354 CCAGCACCCGGCCCGGCCCTTCG No data
Right 1158893614 18:61894373-61894395 CCGGCCGCCCTCCGCGTTCGCGG No data
1158893596_1158893616 22 Left 1158893596 18:61894332-61894354 CCAGCACCCGGCCCGGCCCTTCG No data
Right 1158893616 18:61894377-61894399 CCGCCCTCCGCGTTCGCGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158893596 Original CRISPR CGAAGGGCCGGGCCGGGTGC TGG (reversed) Intergenic