ID: 1158893599

View in Genome Browser
Species Human (GRCh38)
Location 18:61894337-61894359
Sequence ACCCGGCCCGGCCCTTCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158893587_1158893599 25 Left 1158893587 18:61894289-61894311 CCACGGGGCGGACGCTGACAGCG No data
Right 1158893599 18:61894337-61894359 ACCCGGCCCGGCCCTTCGGGCGG No data
1158893592_1158893599 -9 Left 1158893592 18:61894323-61894345 CCTGCAGCCCCAGCACCCGGCCC No data
Right 1158893599 18:61894337-61894359 ACCCGGCCCGGCCCTTCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158893599 Original CRISPR ACCCGGCCCGGCCCTTCGGG CGG Intergenic
No off target data available for this crispr