ID: 1158893601

View in Genome Browser
Species Human (GRCh38)
Location 18:61894339-61894361
Sequence TGCCGCCCGAAGGGCCGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158893601_1158893606 -8 Left 1158893601 18:61894339-61894361 CCGGCCCGGCCCTTCGGGCGGCA No data
Right 1158893606 18:61894354-61894376 GGGCGGCACCCCCACCTGCCCGG No data
1158893601_1158893614 11 Left 1158893601 18:61894339-61894361 CCGGCCCGGCCCTTCGGGCGGCA No data
Right 1158893614 18:61894373-61894395 CCGGCCGCCCTCCGCGTTCGCGG No data
1158893601_1158893616 15 Left 1158893601 18:61894339-61894361 CCGGCCCGGCCCTTCGGGCGGCA No data
Right 1158893616 18:61894377-61894399 CCGCCCTCCGCGTTCGCGGTCGG No data
1158893601_1158893620 29 Left 1158893601 18:61894339-61894361 CCGGCCCGGCCCTTCGGGCGGCA No data
Right 1158893620 18:61894391-61894413 CGCGGTCGGACACCGCCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158893601 Original CRISPR TGCCGCCCGAAGGGCCGGGC CGG (reversed) Intergenic