ID: 1158893602

View in Genome Browser
Species Human (GRCh38)
Location 18:61894343-61894365
Sequence GGGGTGCCGCCCGAAGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158893602_1158893616 11 Left 1158893602 18:61894343-61894365 CCCGGCCCTTCGGGCGGCACCCC No data
Right 1158893616 18:61894377-61894399 CCGCCCTCCGCGTTCGCGGTCGG No data
1158893602_1158893614 7 Left 1158893602 18:61894343-61894365 CCCGGCCCTTCGGGCGGCACCCC No data
Right 1158893614 18:61894373-61894395 CCGGCCGCCCTCCGCGTTCGCGG No data
1158893602_1158893620 25 Left 1158893602 18:61894343-61894365 CCCGGCCCTTCGGGCGGCACCCC No data
Right 1158893620 18:61894391-61894413 CGCGGTCGGACACCGCCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158893602 Original CRISPR GGGGTGCCGCCCGAAGGGCC GGG (reversed) Intergenic
No off target data available for this crispr