ID: 1158893603

View in Genome Browser
Species Human (GRCh38)
Location 18:61894344-61894366
Sequence GGGGGTGCCGCCCGAAGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158893603_1158893614 6 Left 1158893603 18:61894344-61894366 CCGGCCCTTCGGGCGGCACCCCC No data
Right 1158893614 18:61894373-61894395 CCGGCCGCCCTCCGCGTTCGCGG No data
1158893603_1158893620 24 Left 1158893603 18:61894344-61894366 CCGGCCCTTCGGGCGGCACCCCC No data
Right 1158893620 18:61894391-61894413 CGCGGTCGGACACCGCCGCCAGG No data
1158893603_1158893616 10 Left 1158893603 18:61894344-61894366 CCGGCCCTTCGGGCGGCACCCCC No data
Right 1158893616 18:61894377-61894399 CCGCCCTCCGCGTTCGCGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158893603 Original CRISPR GGGGGTGCCGCCCGAAGGGC CGG (reversed) Intergenic