ID: 1158893604

View in Genome Browser
Species Human (GRCh38)
Location 18:61894348-61894370
Sequence AGGTGGGGGTGCCGCCCGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158893604_1158893616 6 Left 1158893604 18:61894348-61894370 CCCTTCGGGCGGCACCCCCACCT No data
Right 1158893616 18:61894377-61894399 CCGCCCTCCGCGTTCGCGGTCGG No data
1158893604_1158893620 20 Left 1158893604 18:61894348-61894370 CCCTTCGGGCGGCACCCCCACCT No data
Right 1158893620 18:61894391-61894413 CGCGGTCGGACACCGCCGCCAGG No data
1158893604_1158893621 27 Left 1158893604 18:61894348-61894370 CCCTTCGGGCGGCACCCCCACCT No data
Right 1158893621 18:61894398-61894420 GGACACCGCCGCCAGGCGCTCGG No data
1158893604_1158893614 2 Left 1158893604 18:61894348-61894370 CCCTTCGGGCGGCACCCCCACCT No data
Right 1158893614 18:61894373-61894395 CCGGCCGCCCTCCGCGTTCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158893604 Original CRISPR AGGTGGGGGTGCCGCCCGAA GGG (reversed) Intergenic