ID: 1158893605

View in Genome Browser
Species Human (GRCh38)
Location 18:61894349-61894371
Sequence CAGGTGGGGGTGCCGCCCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158893605_1158893620 19 Left 1158893605 18:61894349-61894371 CCTTCGGGCGGCACCCCCACCTG No data
Right 1158893620 18:61894391-61894413 CGCGGTCGGACACCGCCGCCAGG No data
1158893605_1158893621 26 Left 1158893605 18:61894349-61894371 CCTTCGGGCGGCACCCCCACCTG No data
Right 1158893621 18:61894398-61894420 GGACACCGCCGCCAGGCGCTCGG No data
1158893605_1158893616 5 Left 1158893605 18:61894349-61894371 CCTTCGGGCGGCACCCCCACCTG No data
Right 1158893616 18:61894377-61894399 CCGCCCTCCGCGTTCGCGGTCGG No data
1158893605_1158893614 1 Left 1158893605 18:61894349-61894371 CCTTCGGGCGGCACCCCCACCTG No data
Right 1158893614 18:61894373-61894395 CCGGCCGCCCTCCGCGTTCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158893605 Original CRISPR CAGGTGGGGGTGCCGCCCGA AGG (reversed) Intergenic
No off target data available for this crispr