ID: 1158893606

View in Genome Browser
Species Human (GRCh38)
Location 18:61894354-61894376
Sequence GGGCGGCACCCCCACCTGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158893601_1158893606 -8 Left 1158893601 18:61894339-61894361 CCGGCCCGGCCCTTCGGGCGGCA No data
Right 1158893606 18:61894354-61894376 GGGCGGCACCCCCACCTGCCCGG No data
1158893592_1158893606 8 Left 1158893592 18:61894323-61894345 CCTGCAGCCCCAGCACCCGGCCC No data
Right 1158893606 18:61894354-61894376 GGGCGGCACCCCCACCTGCCCGG No data
1158893600_1158893606 -7 Left 1158893600 18:61894338-61894360 CCCGGCCCGGCCCTTCGGGCGGC No data
Right 1158893606 18:61894354-61894376 GGGCGGCACCCCCACCTGCCCGG No data
1158893595_1158893606 0 Left 1158893595 18:61894331-61894353 CCCAGCACCCGGCCCGGCCCTTC No data
Right 1158893606 18:61894354-61894376 GGGCGGCACCCCCACCTGCCCGG No data
1158893596_1158893606 -1 Left 1158893596 18:61894332-61894354 CCAGCACCCGGCCCGGCCCTTCG No data
Right 1158893606 18:61894354-61894376 GGGCGGCACCCCCACCTGCCCGG No data
1158893594_1158893606 1 Left 1158893594 18:61894330-61894352 CCCCAGCACCCGGCCCGGCCCTT No data
Right 1158893606 18:61894354-61894376 GGGCGGCACCCCCACCTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158893606 Original CRISPR GGGCGGCACCCCCACCTGCC CGG Intergenic
No off target data available for this crispr