ID: 1158893607

View in Genome Browser
Species Human (GRCh38)
Location 18:61894362-61894384
Sequence GAGGGCGGCCGGGCAGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158893607_1158893616 -8 Left 1158893607 18:61894362-61894384 CCCCCACCTGCCCGGCCGCCCTC No data
Right 1158893616 18:61894377-61894399 CCGCCCTCCGCGTTCGCGGTCGG No data
1158893607_1158893620 6 Left 1158893607 18:61894362-61894384 CCCCCACCTGCCCGGCCGCCCTC No data
Right 1158893620 18:61894391-61894413 CGCGGTCGGACACCGCCGCCAGG No data
1158893607_1158893621 13 Left 1158893607 18:61894362-61894384 CCCCCACCTGCCCGGCCGCCCTC No data
Right 1158893621 18:61894398-61894420 GGACACCGCCGCCAGGCGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158893607 Original CRISPR GAGGGCGGCCGGGCAGGTGG GGG (reversed) Intergenic