ID: 1158893614

View in Genome Browser
Species Human (GRCh38)
Location 18:61894373-61894395
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158893600_1158893614 12 Left 1158893600 18:61894338-61894360 CCCGGCCCGGCCCTTCGGGCGGC No data
Right 1158893614 18:61894373-61894395 CCGGCCGCCCTCCGCGTTCGCGG No data
1158893605_1158893614 1 Left 1158893605 18:61894349-61894371 CCTTCGGGCGGCACCCCCACCTG No data
Right 1158893614 18:61894373-61894395 CCGGCCGCCCTCCGCGTTCGCGG No data
1158893592_1158893614 27 Left 1158893592 18:61894323-61894345 CCTGCAGCCCCAGCACCCGGCCC No data
Right 1158893614 18:61894373-61894395 CCGGCCGCCCTCCGCGTTCGCGG No data
1158893594_1158893614 20 Left 1158893594 18:61894330-61894352 CCCCAGCACCCGGCCCGGCCCTT No data
Right 1158893614 18:61894373-61894395 CCGGCCGCCCTCCGCGTTCGCGG No data
1158893602_1158893614 7 Left 1158893602 18:61894343-61894365 CCCGGCCCTTCGGGCGGCACCCC No data
Right 1158893614 18:61894373-61894395 CCGGCCGCCCTCCGCGTTCGCGG No data
1158893604_1158893614 2 Left 1158893604 18:61894348-61894370 CCCTTCGGGCGGCACCCCCACCT No data
Right 1158893614 18:61894373-61894395 CCGGCCGCCCTCCGCGTTCGCGG No data
1158893603_1158893614 6 Left 1158893603 18:61894344-61894366 CCGGCCCTTCGGGCGGCACCCCC No data
Right 1158893614 18:61894373-61894395 CCGGCCGCCCTCCGCGTTCGCGG No data
1158893595_1158893614 19 Left 1158893595 18:61894331-61894353 CCCAGCACCCGGCCCGGCCCTTC No data
Right 1158893614 18:61894373-61894395 CCGGCCGCCCTCCGCGTTCGCGG No data
1158893596_1158893614 18 Left 1158893596 18:61894332-61894354 CCAGCACCCGGCCCGGCCCTTCG No data
Right 1158893614 18:61894373-61894395 CCGGCCGCCCTCCGCGTTCGCGG No data
1158893601_1158893614 11 Left 1158893601 18:61894339-61894361 CCGGCCCGGCCCTTCGGGCGGCA No data
Right 1158893614 18:61894373-61894395 CCGGCCGCCCTCCGCGTTCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158893614 Original CRISPR CCGGCCGCCCTCCGCGTTCG CGG Intergenic