ID: 1158893616

View in Genome Browser
Species Human (GRCh38)
Location 18:61894377-61894399
Sequence CCGCCCTCCGCGTTCGCGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158893600_1158893616 16 Left 1158893600 18:61894338-61894360 CCCGGCCCGGCCCTTCGGGCGGC No data
Right 1158893616 18:61894377-61894399 CCGCCCTCCGCGTTCGCGGTCGG No data
1158893605_1158893616 5 Left 1158893605 18:61894349-61894371 CCTTCGGGCGGCACCCCCACCTG No data
Right 1158893616 18:61894377-61894399 CCGCCCTCCGCGTTCGCGGTCGG No data
1158893609_1158893616 -10 Left 1158893609 18:61894364-61894386 CCCACCTGCCCGGCCGCCCTCCG No data
Right 1158893616 18:61894377-61894399 CCGCCCTCCGCGTTCGCGGTCGG No data
1158893607_1158893616 -8 Left 1158893607 18:61894362-61894384 CCCCCACCTGCCCGGCCGCCCTC No data
Right 1158893616 18:61894377-61894399 CCGCCCTCCGCGTTCGCGGTCGG No data
1158893608_1158893616 -9 Left 1158893608 18:61894363-61894385 CCCCACCTGCCCGGCCGCCCTCC No data
Right 1158893616 18:61894377-61894399 CCGCCCTCCGCGTTCGCGGTCGG No data
1158893601_1158893616 15 Left 1158893601 18:61894339-61894361 CCGGCCCGGCCCTTCGGGCGGCA No data
Right 1158893616 18:61894377-61894399 CCGCCCTCCGCGTTCGCGGTCGG No data
1158893595_1158893616 23 Left 1158893595 18:61894331-61894353 CCCAGCACCCGGCCCGGCCCTTC No data
Right 1158893616 18:61894377-61894399 CCGCCCTCCGCGTTCGCGGTCGG No data
1158893596_1158893616 22 Left 1158893596 18:61894332-61894354 CCAGCACCCGGCCCGGCCCTTCG No data
Right 1158893616 18:61894377-61894399 CCGCCCTCCGCGTTCGCGGTCGG No data
1158893604_1158893616 6 Left 1158893604 18:61894348-61894370 CCCTTCGGGCGGCACCCCCACCT No data
Right 1158893616 18:61894377-61894399 CCGCCCTCCGCGTTCGCGGTCGG No data
1158893603_1158893616 10 Left 1158893603 18:61894344-61894366 CCGGCCCTTCGGGCGGCACCCCC No data
Right 1158893616 18:61894377-61894399 CCGCCCTCCGCGTTCGCGGTCGG No data
1158893594_1158893616 24 Left 1158893594 18:61894330-61894352 CCCCAGCACCCGGCCCGGCCCTT No data
Right 1158893616 18:61894377-61894399 CCGCCCTCCGCGTTCGCGGTCGG No data
1158893602_1158893616 11 Left 1158893602 18:61894343-61894365 CCCGGCCCTTCGGGCGGCACCCC No data
Right 1158893616 18:61894377-61894399 CCGCCCTCCGCGTTCGCGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158893616 Original CRISPR CCGCCCTCCGCGTTCGCGGT CGG Intergenic
No off target data available for this crispr