ID: 1158893620

View in Genome Browser
Species Human (GRCh38)
Location 18:61894391-61894413
Sequence CGCGGTCGGACACCGCCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158893608_1158893620 5 Left 1158893608 18:61894363-61894385 CCCCACCTGCCCGGCCGCCCTCC No data
Right 1158893620 18:61894391-61894413 CGCGGTCGGACACCGCCGCCAGG No data
1158893607_1158893620 6 Left 1158893607 18:61894362-61894384 CCCCCACCTGCCCGGCCGCCCTC No data
Right 1158893620 18:61894391-61894413 CGCGGTCGGACACCGCCGCCAGG No data
1158893613_1158893620 -5 Left 1158893613 18:61894373-61894395 CCGGCCGCCCTCCGCGTTCGCGG No data
Right 1158893620 18:61894391-61894413 CGCGGTCGGACACCGCCGCCAGG No data
1158893610_1158893620 3 Left 1158893610 18:61894365-61894387 CCACCTGCCCGGCCGCCCTCCGC No data
Right 1158893620 18:61894391-61894413 CGCGGTCGGACACCGCCGCCAGG No data
1158893604_1158893620 20 Left 1158893604 18:61894348-61894370 CCCTTCGGGCGGCACCCCCACCT No data
Right 1158893620 18:61894391-61894413 CGCGGTCGGACACCGCCGCCAGG No data
1158893612_1158893620 -4 Left 1158893612 18:61894372-61894394 CCCGGCCGCCCTCCGCGTTCGCG No data
Right 1158893620 18:61894391-61894413 CGCGGTCGGACACCGCCGCCAGG No data
1158893611_1158893620 0 Left 1158893611 18:61894368-61894390 CCTGCCCGGCCGCCCTCCGCGTT No data
Right 1158893620 18:61894391-61894413 CGCGGTCGGACACCGCCGCCAGG No data
1158893603_1158893620 24 Left 1158893603 18:61894344-61894366 CCGGCCCTTCGGGCGGCACCCCC No data
Right 1158893620 18:61894391-61894413 CGCGGTCGGACACCGCCGCCAGG No data
1158893609_1158893620 4 Left 1158893609 18:61894364-61894386 CCCACCTGCCCGGCCGCCCTCCG No data
Right 1158893620 18:61894391-61894413 CGCGGTCGGACACCGCCGCCAGG No data
1158893600_1158893620 30 Left 1158893600 18:61894338-61894360 CCCGGCCCGGCCCTTCGGGCGGC No data
Right 1158893620 18:61894391-61894413 CGCGGTCGGACACCGCCGCCAGG No data
1158893602_1158893620 25 Left 1158893602 18:61894343-61894365 CCCGGCCCTTCGGGCGGCACCCC No data
Right 1158893620 18:61894391-61894413 CGCGGTCGGACACCGCCGCCAGG No data
1158893605_1158893620 19 Left 1158893605 18:61894349-61894371 CCTTCGGGCGGCACCCCCACCTG No data
Right 1158893620 18:61894391-61894413 CGCGGTCGGACACCGCCGCCAGG No data
1158893615_1158893620 -9 Left 1158893615 18:61894377-61894399 CCGCCCTCCGCGTTCGCGGTCGG No data
Right 1158893620 18:61894391-61894413 CGCGGTCGGACACCGCCGCCAGG No data
1158893601_1158893620 29 Left 1158893601 18:61894339-61894361 CCGGCCCGGCCCTTCGGGCGGCA No data
Right 1158893620 18:61894391-61894413 CGCGGTCGGACACCGCCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158893620 Original CRISPR CGCGGTCGGACACCGCCGCC AGG Intergenic
No off target data available for this crispr