ID: 1158893621

View in Genome Browser
Species Human (GRCh38)
Location 18:61894398-61894420
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158893607_1158893621 13 Left 1158893607 18:61894362-61894384 CCCCCACCTGCCCGGCCGCCCTC No data
Right 1158893621 18:61894398-61894420 GGACACCGCCGCCAGGCGCTCGG No data
1158893618_1158893621 -6 Left 1158893618 18:61894381-61894403 CCTCCGCGTTCGCGGTCGGACAC No data
Right 1158893621 18:61894398-61894420 GGACACCGCCGCCAGGCGCTCGG No data
1158893617_1158893621 -5 Left 1158893617 18:61894380-61894402 CCCTCCGCGTTCGCGGTCGGACA No data
Right 1158893621 18:61894398-61894420 GGACACCGCCGCCAGGCGCTCGG No data
1158893611_1158893621 7 Left 1158893611 18:61894368-61894390 CCTGCCCGGCCGCCCTCCGCGTT No data
Right 1158893621 18:61894398-61894420 GGACACCGCCGCCAGGCGCTCGG No data
1158893615_1158893621 -2 Left 1158893615 18:61894377-61894399 CCGCCCTCCGCGTTCGCGGTCGG No data
Right 1158893621 18:61894398-61894420 GGACACCGCCGCCAGGCGCTCGG No data
1158893608_1158893621 12 Left 1158893608 18:61894363-61894385 CCCCACCTGCCCGGCCGCCCTCC No data
Right 1158893621 18:61894398-61894420 GGACACCGCCGCCAGGCGCTCGG No data
1158893619_1158893621 -9 Left 1158893619 18:61894384-61894406 CCGCGTTCGCGGTCGGACACCGC No data
Right 1158893621 18:61894398-61894420 GGACACCGCCGCCAGGCGCTCGG No data
1158893605_1158893621 26 Left 1158893605 18:61894349-61894371 CCTTCGGGCGGCACCCCCACCTG No data
Right 1158893621 18:61894398-61894420 GGACACCGCCGCCAGGCGCTCGG No data
1158893609_1158893621 11 Left 1158893609 18:61894364-61894386 CCCACCTGCCCGGCCGCCCTCCG No data
Right 1158893621 18:61894398-61894420 GGACACCGCCGCCAGGCGCTCGG No data
1158893612_1158893621 3 Left 1158893612 18:61894372-61894394 CCCGGCCGCCCTCCGCGTTCGCG No data
Right 1158893621 18:61894398-61894420 GGACACCGCCGCCAGGCGCTCGG No data
1158893613_1158893621 2 Left 1158893613 18:61894373-61894395 CCGGCCGCCCTCCGCGTTCGCGG No data
Right 1158893621 18:61894398-61894420 GGACACCGCCGCCAGGCGCTCGG No data
1158893604_1158893621 27 Left 1158893604 18:61894348-61894370 CCCTTCGGGCGGCACCCCCACCT No data
Right 1158893621 18:61894398-61894420 GGACACCGCCGCCAGGCGCTCGG No data
1158893610_1158893621 10 Left 1158893610 18:61894365-61894387 CCACCTGCCCGGCCGCCCTCCGC No data
Right 1158893621 18:61894398-61894420 GGACACCGCCGCCAGGCGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158893621 Original CRISPR GGACACCGCCGCCAGGCGCT CGG Intergenic
No off target data available for this crispr