ID: 1158894134

View in Genome Browser
Species Human (GRCh38)
Location 18:61897361-61897383
Sequence CAGAACTTACATTCTAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158894124_1158894134 27 Left 1158894124 18:61897311-61897333 CCTGGTCCTAGGGTTAGGATAGA No data
Right 1158894134 18:61897361-61897383 CAGAACTTACATTCTAATGGAGG No data
1158894128_1158894134 -5 Left 1158894128 18:61897343-61897365 CCCAAATTCCTGCCCTCACAGAA No data
Right 1158894134 18:61897361-61897383 CAGAACTTACATTCTAATGGAGG No data
1158894127_1158894134 -4 Left 1158894127 18:61897342-61897364 CCCCAAATTCCTGCCCTCACAGA No data
Right 1158894134 18:61897361-61897383 CAGAACTTACATTCTAATGGAGG No data
1158894125_1158894134 21 Left 1158894125 18:61897317-61897339 CCTAGGGTTAGGATAGAGAAAAC No data
Right 1158894134 18:61897361-61897383 CAGAACTTACATTCTAATGGAGG No data
1158894126_1158894134 -3 Left 1158894126 18:61897341-61897363 CCCCCAAATTCCTGCCCTCACAG No data
Right 1158894134 18:61897361-61897383 CAGAACTTACATTCTAATGGAGG No data
1158894129_1158894134 -6 Left 1158894129 18:61897344-61897366 CCAAATTCCTGCCCTCACAGAAC No data
Right 1158894134 18:61897361-61897383 CAGAACTTACATTCTAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158894134 Original CRISPR CAGAACTTACATTCTAATGG AGG Intergenic
No off target data available for this crispr