ID: 1158895430

View in Genome Browser
Species Human (GRCh38)
Location 18:61908601-61908623
Sequence ATGTGAAAATGTAAAGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158895430_1158895431 23 Left 1158895430 18:61908601-61908623 CCTACTTCTTTACATTTTCACAT No data
Right 1158895431 18:61908647-61908669 GCTCTTTTGATAATCCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158895430 Original CRISPR ATGTGAAAATGTAAAGAAGT AGG (reversed) Intergenic
No off target data available for this crispr