ID: 1158896245

View in Genome Browser
Species Human (GRCh38)
Location 18:61916470-61916492
Sequence CTCTTGGGGCCTCCCACTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158896245_1158896253 2 Left 1158896245 18:61916470-61916492 CCGGAAGTGGGAGGCCCCAAGAG No data
Right 1158896253 18:61916495-61916517 CCCTTCCCAGAGGCCAGAGAGGG No data
1158896245_1158896258 22 Left 1158896245 18:61916470-61916492 CCGGAAGTGGGAGGCCCCAAGAG No data
Right 1158896258 18:61916515-61916537 GGGCATTTTGAAGAAGACGTCGG No data
1158896245_1158896259 26 Left 1158896245 18:61916470-61916492 CCGGAAGTGGGAGGCCCCAAGAG No data
Right 1158896259 18:61916519-61916541 ATTTTGAAGAAGACGTCGGAAGG No data
1158896245_1158896251 1 Left 1158896245 18:61916470-61916492 CCGGAAGTGGGAGGCCCCAAGAG No data
Right 1158896251 18:61916494-61916516 CCCCTTCCCAGAGGCCAGAGAGG No data
1158896245_1158896248 -8 Left 1158896245 18:61916470-61916492 CCGGAAGTGGGAGGCCCCAAGAG No data
Right 1158896248 18:61916485-61916507 CCCAAGAGACCCCTTCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158896245 Original CRISPR CTCTTGGGGCCTCCCACTTC CGG (reversed) Intergenic
No off target data available for this crispr