ID: 1158896744

View in Genome Browser
Species Human (GRCh38)
Location 18:61921352-61921374
Sequence GTGCAGAGGCAGGATCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158896744_1158896748 8 Left 1158896744 18:61921352-61921374 CCTGGCTGATCCTGCCTCTGCAC No data
Right 1158896748 18:61921383-61921405 CAGTGCTTTCTTCAGTAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158896744 Original CRISPR GTGCAGAGGCAGGATCAGCC AGG (reversed) Intergenic
No off target data available for this crispr