ID: 1158900407

View in Genome Browser
Species Human (GRCh38)
Location 18:61957151-61957173
Sequence CAGGGTGGACAACTGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158900407_1158900419 26 Left 1158900407 18:61957151-61957173 CCTTCTGCCAGTTGTCCACCCTG No data
Right 1158900419 18:61957200-61957222 CTGGAAAGAAACATCCCCCTTGG No data
1158900407_1158900415 7 Left 1158900407 18:61957151-61957173 CCTTCTGCCAGTTGTCCACCCTG No data
Right 1158900415 18:61957181-61957203 CACATGAAGGCAAAGGCCCCTGG No data
1158900407_1158900411 -6 Left 1158900407 18:61957151-61957173 CCTTCTGCCAGTTGTCCACCCTG No data
Right 1158900411 18:61957168-61957190 ACCCTGGCACAGACACATGAAGG No data
1158900407_1158900414 0 Left 1158900407 18:61957151-61957173 CCTTCTGCCAGTTGTCCACCCTG No data
Right 1158900414 18:61957174-61957196 GCACAGACACATGAAGGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158900407 Original CRISPR CAGGGTGGACAACTGGCAGA AGG (reversed) Intergenic
No off target data available for this crispr