ID: 1158906054

View in Genome Browser
Species Human (GRCh38)
Location 18:62012910-62012932
Sequence CTGTGGTTATGGAGAGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158906054_1158906060 28 Left 1158906054 18:62012910-62012932 CCCTGCTCTCTCCATAACCACAG No data
Right 1158906060 18:62012961-62012983 TTCTTTATGGCACCTTCAACTGG No data
1158906054_1158906059 15 Left 1158906054 18:62012910-62012932 CCCTGCTCTCTCCATAACCACAG No data
Right 1158906059 18:62012948-62012970 TATTGCAACTTTCTTCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158906054 Original CRISPR CTGTGGTTATGGAGAGAGCA GGG (reversed) Intergenic
No off target data available for this crispr