ID: 1158907329

View in Genome Browser
Species Human (GRCh38)
Location 18:62026689-62026711
Sequence TAGCAGAGGCAGAGTCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158907329_1158907334 22 Left 1158907329 18:62026689-62026711 CCTTCCTGACTCTGCCTCTGCTA No data
Right 1158907334 18:62026734-62026756 TTCCAGAATGAATTTGTCTTGGG No data
1158907329_1158907333 21 Left 1158907329 18:62026689-62026711 CCTTCCTGACTCTGCCTCTGCTA No data
Right 1158907333 18:62026733-62026755 ATTCCAGAATGAATTTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158907329 Original CRISPR TAGCAGAGGCAGAGTCAGGA AGG (reversed) Intergenic
No off target data available for this crispr