ID: 1158907334

View in Genome Browser
Species Human (GRCh38)
Location 18:62026734-62026756
Sequence TTCCAGAATGAATTTGTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158907328_1158907334 29 Left 1158907328 18:62026682-62026704 CCAACAGCCTTCCTGACTCTGCC No data
Right 1158907334 18:62026734-62026756 TTCCAGAATGAATTTGTCTTGGG No data
1158907327_1158907334 30 Left 1158907327 18:62026681-62026703 CCCAACAGCCTTCCTGACTCTGC No data
Right 1158907334 18:62026734-62026756 TTCCAGAATGAATTTGTCTTGGG No data
1158907330_1158907334 18 Left 1158907330 18:62026693-62026715 CCTGACTCTGCCTCTGCTACTGC No data
Right 1158907334 18:62026734-62026756 TTCCAGAATGAATTTGTCTTGGG No data
1158907331_1158907334 8 Left 1158907331 18:62026703-62026725 CCTCTGCTACTGCCACTCTTGTC No data
Right 1158907334 18:62026734-62026756 TTCCAGAATGAATTTGTCTTGGG No data
1158907332_1158907334 -4 Left 1158907332 18:62026715-62026737 CCACTCTTGTCAAAAGACATTCC No data
Right 1158907334 18:62026734-62026756 TTCCAGAATGAATTTGTCTTGGG No data
1158907329_1158907334 22 Left 1158907329 18:62026689-62026711 CCTTCCTGACTCTGCCTCTGCTA No data
Right 1158907334 18:62026734-62026756 TTCCAGAATGAATTTGTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158907334 Original CRISPR TTCCAGAATGAATTTGTCTT GGG Intergenic
No off target data available for this crispr