ID: 1158907561

View in Genome Browser
Species Human (GRCh38)
Location 18:62028756-62028778
Sequence CTTAGAATATGGAGCTAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158907558_1158907561 -1 Left 1158907558 18:62028734-62028756 CCCAGTTCTGTTTTCTTAGCTTC No data
Right 1158907561 18:62028756-62028778 CTTAGAATATGGAGCTAACAAGG No data
1158907559_1158907561 -2 Left 1158907559 18:62028735-62028757 CCAGTTCTGTTTTCTTAGCTTCT No data
Right 1158907561 18:62028756-62028778 CTTAGAATATGGAGCTAACAAGG No data
1158907557_1158907561 15 Left 1158907557 18:62028718-62028740 CCTTTGATAGCAGCATCCCAGTT No data
Right 1158907561 18:62028756-62028778 CTTAGAATATGGAGCTAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158907561 Original CRISPR CTTAGAATATGGAGCTAACA AGG Intergenic
No off target data available for this crispr