ID: 1158908388

View in Genome Browser
Species Human (GRCh38)
Location 18:62036095-62036117
Sequence AAGGAACATCAGCTCCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158908379_1158908388 30 Left 1158908379 18:62036042-62036064 CCTCCAGCAGCATGCCTACATTT No data
Right 1158908388 18:62036095-62036117 AAGGAACATCAGCTCCACTGAGG No data
1158908383_1158908388 16 Left 1158908383 18:62036056-62036078 CCTACATTTCAGATACAGGAGGA No data
Right 1158908388 18:62036095-62036117 AAGGAACATCAGCTCCACTGAGG No data
1158908380_1158908388 27 Left 1158908380 18:62036045-62036067 CCAGCAGCATGCCTACATTTCAG No data
Right 1158908388 18:62036095-62036117 AAGGAACATCAGCTCCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158908388 Original CRISPR AAGGAACATCAGCTCCACTG AGG Intergenic