ID: 1158909551

View in Genome Browser
Species Human (GRCh38)
Location 18:62046560-62046582
Sequence CGCTGTGTATGTGGGGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 319}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158909551_1158909560 27 Left 1158909551 18:62046560-62046582 CCCTCACCCCCACATACACAGCG 0: 1
1: 0
2: 2
3: 25
4: 319
Right 1158909560 18:62046610-62046632 ACTACTCCCTTATGCCAAAAAGG 0: 1
1: 0
2: 16
3: 183
4: 1445

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158909551 Original CRISPR CGCTGTGTATGTGGGGGTGA GGG (reversed) Intronic
900679412 1:3908118-3908140 CTCTGGGTTTGTGGGGGTGTTGG + Intergenic
901613363 1:10517287-10517309 GGCAGTGGAGGTGGGGGTGAGGG + Intronic
901684155 1:10934499-10934521 GGATGTGGATGTGGGGGTCAGGG - Intergenic
902574829 1:17371249-17371271 AGCTGTGTCGGTGGGGGTGGGGG - Intergenic
903172140 1:21560919-21560941 CCCTGAGGATCTGGGGGTGAAGG + Intronic
903184440 1:21621408-21621430 CTGTGTGTGTGTGCGGGTGAGGG - Intronic
903571675 1:24310385-24310407 TTCTGTGTATGTGTGTGTGAGGG + Intergenic
905194767 1:36267236-36267258 GTATGTGTATGTGTGGGTGAGGG + Intronic
905240611 1:36578653-36578675 CTCTGTGGAGCTGGGGGTGATGG - Intergenic
905520039 1:38590462-38590484 GGGTGTGTATGTGGGGGCGGGGG - Intergenic
905557352 1:38897712-38897734 CCTTTTGTGTGTGGGGGTGAGGG - Intronic
906233694 1:44188998-44189020 CAGTGAGTATGTGGTGGTGATGG - Intergenic
906412025 1:45586147-45586169 TGCTGGGTGTGTGGGGGTGGGGG + Intronic
907250992 1:53139418-53139440 CCCTGTGTGTGTTGGGGAGAGGG - Intronic
907561773 1:55397531-55397553 CTATGTGTATGTGAGGGTGTTGG - Intergenic
908111751 1:60904850-60904872 TGCTCTGTGGGTGGGGGTGAGGG - Intronic
910468514 1:87525755-87525777 CTCAGTGTATGTGAGGGAGAGGG + Intergenic
910879791 1:91913045-91913067 AAGTGTGTACGTGGGGGTGAGGG + Intergenic
911126920 1:94349044-94349066 CGCTCTGTGTATGGGGGTTAGGG - Intergenic
912023442 1:105137740-105137762 TGGTGTGTTTGCGGGGGTGAGGG - Intergenic
912709587 1:111940846-111940868 GGGTGTGTATGTGGGGTGGAAGG - Intronic
915172386 1:153986955-153986977 GGCTGTGTGTGTTGGGGTGGTGG - Intergenic
915241382 1:154524809-154524831 CGCTGTGAAGGTGGGGGAGAGGG - Intronic
916076119 1:161200857-161200879 AGCAGTGTGTGTGGGGGTGTTGG + Intronic
917974993 1:180232770-180232792 AGTTGTGTATATGTGGGTGATGG - Intronic
924609888 1:245564836-245564858 AGCTGTGCATGTGGGGGTCTAGG - Intronic
1064861890 10:19835562-19835584 CGAGGTGTATCTGGTGGTGATGG + Intronic
1064934832 10:20668089-20668111 CCCAGCGTATGTGGGGTTGAGGG + Intergenic
1066513308 10:36126518-36126540 CGATGTGTATGTGTGTGTGTGGG - Intergenic
1069586928 10:69612751-69612773 GGCTATGTATGTGTGGGGGAAGG + Intergenic
1069745739 10:70713734-70713756 CGCTGTGTATGGGGGTGAGTTGG + Intronic
1070154581 10:73825472-73825494 CGCTGTGTAGATGGGAGCGATGG + Intronic
1070467770 10:76741702-76741724 CTCTGTGAATGAGGAGGTGAGGG + Intergenic
1070667505 10:78355798-78355820 CTCTGAGTATGGGGGGGTTATGG + Intergenic
1070775721 10:79108648-79108670 CTGTGTGTATTAGGGGGTGATGG - Intronic
1071290677 10:84186503-84186525 CGATGTGTATGTGAGGGTACAGG + Intergenic
1073049432 10:100657897-100657919 AGCTGGGGAGGTGGGGGTGAGGG + Intergenic
1074372714 10:112913310-112913332 GGGTGTGTATGTGTGTGTGAGGG + Intergenic
1074373125 10:112916662-112916684 TTCTGTGTTTCTGGGGGTGAGGG + Intergenic
1075242778 10:120793266-120793288 CAGTGTGTGTGTGGGGGGGAGGG - Intergenic
1075323592 10:121512019-121512041 CGCTGTGTGTGTATGGGTGTTGG + Intronic
1075698129 10:124450317-124450339 AGGTGTGTGTGTCGGGGTGAGGG - Intergenic
1076307502 10:129475329-129475351 GGCTGTGTGTGTCTGGGTGATGG + Intronic
1077542515 11:3153985-3154007 TGCTGTGTGTGCGGGGCTGACGG - Intronic
1081510910 11:43772419-43772441 CACTGTGCATGAAGGGGTGATGG - Intronic
1082635714 11:55590988-55591010 GGCTATGTATGTGGGGGGCAGGG - Intergenic
1084089454 11:66870514-66870536 CAGTGGTTATGTGGGGGTGATGG - Intronic
1084268297 11:68016171-68016193 TGTTGTATATGTGGGGGTCAGGG + Intronic
1084719197 11:70893323-70893345 TGCTGGGTATGTGGTGGGGAGGG - Intronic
1085026574 11:73239962-73239984 GGGTGTGCTTGTGGGGGTGAAGG + Intergenic
1085390673 11:76180551-76180573 CGCTGTGTATGTGCAGGAGGTGG + Intergenic
1086246913 11:84763891-84763913 AACTGTGTTTGTTGGGGTGAGGG + Intronic
1086769208 11:90740154-90740176 GTCAGTGAATGTGGGGGTGAAGG + Intergenic
1087066624 11:94033488-94033510 CGCTGTGGATATGAGGGTGGGGG - Intronic
1087688012 11:101287062-101287084 TGCTGTGTGTGAGGGGGTGGGGG - Intergenic
1088837931 11:113594138-113594160 TAGTGTGTATGTGGGGGTGGGGG + Intergenic
1090035417 11:123245666-123245688 CACTGTGTTTGTGGGTGTGGTGG + Intergenic
1090893156 11:130945585-130945607 AGCTGTGTATGTGGGGAGCAGGG - Intergenic
1091196933 11:133739162-133739184 GGGTGTGTATGGGGGGGTGTGGG + Intergenic
1092116363 12:6011488-6011510 CACTGTGCATGTGGTGATGAGGG + Intronic
1092920470 12:13227227-13227249 TGCTGTCTATGTGTGTGTGATGG - Intergenic
1093467248 12:19462200-19462222 AGCTGTGTGTGTGGGGGTGTGGG + Intronic
1095262382 12:40111279-40111301 TCTTGTGTATTTGGGGGTGAGGG + Intergenic
1095522786 12:43086695-43086717 GGCTGTGCATGTGTGGGTGTAGG + Intergenic
1095921651 12:47537774-47537796 GGGTGTGAGTGTGGGGGTGAGGG + Intergenic
1096001317 12:48132967-48132989 CTCTGTGTCATTGGGGGTGATGG + Exonic
1097231765 12:57516692-57516714 CCCTGCGTATGTGGGATTGAGGG + Exonic
1098381911 12:69878895-69878917 TGCTGGGCATGGGGGGGTGAGGG - Intronic
1098541717 12:71664347-71664369 GGGTGTGTATGTGGGGGCGGAGG - Exonic
1099439278 12:82682197-82682219 GTCTGAGAATGTGGGGGTGAGGG - Intergenic
1102592669 12:113968857-113968879 CCCAGTGTGTGTGGTGGTGAGGG - Intergenic
1102746108 12:115250545-115250567 AGCTGTTTATGTGGTGGTTATGG - Intergenic
1103446660 12:120999434-120999456 CCCGGGGGATGTGGGGGTGAGGG - Intronic
1103937116 12:124482630-124482652 AGCTGTGGAGGTGGGGGTGGTGG + Intronic
1103964099 12:124627156-124627178 CTCTGTGTCGATGGGGGTGATGG - Intergenic
1104534133 12:129602694-129602716 GGCTGTGTATGTGTGGGGAAGGG - Intronic
1104607005 12:130197211-130197233 CTCTGTGTGTGTGAGAGTGAGGG + Intergenic
1104834336 12:131777960-131777982 TGCTGTGTTTGTTGGTGTGAGGG + Intronic
1106127747 13:26914163-26914185 CCCTGTGTATGTGGTGGCGTGGG + Intergenic
1106408127 13:29491492-29491514 GTGTGTGTATGTGGGGGTGTGGG + Intronic
1109549783 13:63879212-63879234 TGGGGTGTATGTGAGGGTGAAGG + Intergenic
1110705907 13:78602089-78602111 GGCTGTGCATATGCGGGTGAGGG + Exonic
1112374483 13:98825896-98825918 CGCTATGGCTGTGGGGGAGAAGG + Exonic
1113263498 13:108592229-108592251 AGCTGTGTGTGTGGGAGTGTGGG + Intergenic
1113499676 13:110763615-110763637 TGCTGTGGACGTGGGGGTGCAGG + Intergenic
1114413321 14:22520336-22520358 TGCTGTGGATTTGGGGGTGGAGG + Intergenic
1114444576 14:22778446-22778468 AGCTATGTATGTGGGGATAAGGG + Intronic
1114463444 14:22903167-22903189 TTGTGTGTATGTGGGGGTGTGGG - Intronic
1114997149 14:28368476-28368498 TGCTGTATATATGGAGGTGAAGG + Intergenic
1115750022 14:36480005-36480027 CCAAGTGTATTTGGGGGTGAAGG - Intronic
1118718000 14:68573938-68573960 TGCTGTGTGTGTGGGGGTGTGGG + Intronic
1120626032 14:86827582-86827604 GGCTGTGTCTGTGAGGGTGTTGG + Intergenic
1121530008 14:94645663-94645685 TGCTTTGAGTGTGGGGGTGAAGG - Intergenic
1121812100 14:96900466-96900488 CCCTGCCTATGGGGGGGTGAGGG + Intronic
1123010395 14:105346937-105346959 TGCTGTGCAGGTGGGGGTGGGGG - Intronic
1124366487 15:29075255-29075277 TGGTGTGTGTGTGGGGGTGGGGG + Intronic
1124845417 15:33285009-33285031 GGCTGTGTATCTGAGAGTGATGG + Intergenic
1125428250 15:39571296-39571318 GGTTGTGTGTGTGGGGTTGAGGG - Intergenic
1125460170 15:39898848-39898870 CACTGTGTGGGTGGGGGAGAAGG + Intronic
1125722519 15:41852099-41852121 GGCTGGGGCTGTGGGGGTGAGGG - Intronic
1126023782 15:44427092-44427114 CGCTGGGTAGGTGGAGCTGAGGG - Intergenic
1127878682 15:63135849-63135871 CTCTGTGTATAAGGGGGAGAAGG + Intronic
1128127015 15:65200656-65200678 GATTGTGTATGTGGAGGTGAGGG - Intronic
1129083076 15:73058583-73058605 GTGTGTGTATGTGGGGGTCAGGG + Intronic
1129441507 15:75584249-75584271 AGCTGTGTGTGTGGGCGTGTGGG + Intergenic
1129737946 15:77976199-77976221 CGGTGTGGGTGTGGGGGTGTGGG + Intergenic
1129848133 15:78777410-78777432 CGGTGTGGGTGTGGGGGTGTGGG - Intronic
1130253788 15:82316526-82316548 CGGTGTGGGTGTGGGGGTGTGGG + Intergenic
1131163525 15:90125811-90125833 CGCTGTTCATGTGGGGCAGATGG + Intergenic
1131811845 15:96180995-96181017 TGCTGTGAATGTGGGGATGGAGG - Intergenic
1132678724 16:1131056-1131078 CGCAGTGTGGGTGGGGGTCAGGG + Intergenic
1132725494 16:1336592-1336614 TGCTGTGTCTGTGGGGGTTCAGG - Intronic
1134226825 16:12397832-12397854 CACTGTGGAGGTGGGGGTGAGGG - Intronic
1134871293 16:17654497-17654519 CTATGTGTATGTGAGGGGGAGGG + Intergenic
1135964537 16:27024868-27024890 CACTGTGTGTGTGGGGGGGGGGG - Intergenic
1137756034 16:50903015-50903037 GCCTGTGTATGTGGTGGTGGAGG + Intergenic
1138093948 16:54197469-54197491 AGCTGTGTATGTGCAGGTGTGGG + Intergenic
1138782699 16:59808284-59808306 CCCTGTGGGTGTGGGTGTGAGGG - Intergenic
1140002641 16:71040491-71040513 AGTTGTGTGTGTGGGGGGGAGGG - Intronic
1140043999 16:71427735-71427757 TGCTGTGTATGTGGGTGGGGTGG + Intergenic
1140111902 16:72011967-72011989 CTCTGTGTACCTGGGTGTGAAGG + Intronic
1140402860 16:74685657-74685679 CTCTGTGTATGTGGGGGCGGGGG + Intronic
1140621967 16:76746047-76746069 GTGTGTATATGTGGGGGTGAGGG + Intergenic
1141007103 16:80362869-80362891 GTGTGTGTATGTGGGGGTGAGGG + Intergenic
1141441621 16:84033016-84033038 GGGTGTGTATGTGTGGGTGTGGG + Intronic
1141633632 16:85302453-85302475 CGGTGTGTGTGTGGGGGCGGGGG - Intergenic
1142139557 16:88466758-88466780 GGGTGTGTATGTGGGGGAGGGGG + Intronic
1142288160 16:89179880-89179902 CGCTGAGTAGATGGAGGTGAAGG + Intronic
1142406455 16:89892941-89892963 GCCTGTGTCTGTGGGGGTGCCGG + Intronic
1143258525 17:5581968-5581990 TGCTGTGGATGTGGGGGCGTTGG + Exonic
1144294723 17:13862997-13863019 AACTGTTTATGTGGGTGTGAGGG - Intergenic
1144426263 17:15145106-15145128 CTCTGTGTGTGTGGGGGAGGGGG - Intergenic
1146468553 17:33106549-33106571 CACTGAGTGAGTGGGGGTGAGGG - Intronic
1146776737 17:35625750-35625772 TGCTGGGCATTTGGGGGTGAGGG + Intronic
1146904996 17:36612536-36612558 GGCTGTGGCTGTGGGTGTGAAGG + Intergenic
1147250830 17:39151658-39151680 CGCTGGGTCGGTGGGGGTGGGGG + Intronic
1147596774 17:41722941-41722963 CTCTGTGTGTGGGTGGGTGAGGG - Exonic
1148772636 17:50076087-50076109 CCCTGTGGATGGGGAGGTGAAGG + Intronic
1149002234 17:51769476-51769498 GTGTGTGTATTTGGGGGTGATGG + Intronic
1149546398 17:57506891-57506913 TGGTGTGTATGTTGGGGTCAGGG + Intronic
1150061087 17:62068699-62068721 GGCTGTGTATGTGTGGGGGCAGG + Intergenic
1151891492 17:76953365-76953387 GCCTGTGTATGTGGGGGAGGTGG - Intergenic
1152025212 17:77804566-77804588 CGGTGTGTGTGTGTGGGTGGCGG - Intergenic
1152235909 17:79138597-79138619 TGCTATGTGTGTGTGGGTGAGGG - Intronic
1152235915 17:79138638-79138660 TGCTGTGTATGTGCGTGTGTGGG - Intronic
1153444188 18:5153885-5153907 GGCTGTGAATGTGTGGGGGAAGG + Intronic
1156015054 18:32537989-32538011 CAATTTGTGTGTGGGGGTGAGGG - Intergenic
1157072679 18:44427472-44427494 CGCTGTGTATATGTGGGGAAGGG - Intergenic
1157191319 18:45584412-45584434 GGCTTTGTATGTGGGGTTGAAGG + Intronic
1158909551 18:62046560-62046582 CGCTGTGTATGTGGGGGTGAGGG - Intronic
1159933583 18:74340842-74340864 GGCTGGGTAGGTGGGAGTGAAGG + Intronic
1159948774 18:74463581-74463603 TGCCGGGTACGTGGGGGTGAGGG - Intergenic
1160523169 18:79520522-79520544 CTCTGTGTGTGGGGGGGGGAGGG + Intronic
1161375358 19:3937044-3937066 CGCTGTGTGGGTGTGGGTGGGGG + Intronic
1161658347 19:5529915-5529937 GGCTGGGAAGGTGGGGGTGATGG + Intergenic
1162481450 19:10929099-10929121 CGCTGTGTATGTGGGTCTGCTGG + Exonic
1165024611 19:32950558-32950580 TGCTTTTTTTGTGGGGGTGAAGG - Intronic
1166777934 19:45323671-45323693 CGCTGGGTATGGGGGGGTTCGGG + Intergenic
1167701749 19:51052195-51052217 AACTGTGTCTGTGGGGGTGAGGG - Intergenic
925059256 2:878481-878503 GCATGTGTATGTAGGGGTGAGGG - Intergenic
925122124 2:1427466-1427488 CCATGAGTGTGTGGGGGTGAGGG + Intronic
925280824 2:2683268-2683290 GGGTGTGTGTGTGGTGGTGACGG + Intergenic
925727163 2:6884286-6884308 CGCTGTGGATGTGGGTTGGAGGG + Intronic
925776628 2:7342342-7342364 TTCTGTGTATGTGGTGGTAATGG - Intergenic
926238878 2:11069750-11069772 CTCTGTGTGGGTGGGGGTGCAGG + Intergenic
926266176 2:11323747-11323769 CTATGTGTATGCAGGGGTGAGGG - Intronic
926717834 2:15939150-15939172 CACTGTGTATTTGGTTGTGAAGG + Intergenic
926731031 2:16035806-16035828 AGCTTTGGAGGTGGGGGTGATGG + Intergenic
927574704 2:24191294-24191316 TCCTGTGTGTGTGGTGGTGAGGG - Exonic
928713672 2:34035635-34035657 GGCTGTGCATGTGGGAGTGATGG + Intergenic
928867346 2:35933033-35933055 GGGTGTGTATGTGGTGGTGGTGG - Intergenic
929125151 2:38516748-38516770 GGCTATGTATGTGGGGGGCAGGG + Intergenic
931869276 2:66441498-66441520 CCCTGTGTGTTTGGGGGTAAGGG - Intronic
932342607 2:70975833-70975855 CCCTGTGTATGTGGTGGGGTTGG - Intronic
933155506 2:78968885-78968907 TGCTGTGGATGGAGGGGTGAGGG - Intergenic
933274307 2:80267230-80267252 TACAGTGTATGTGGTGGTGAAGG + Intronic
935350345 2:102147105-102147127 TGCTTTGTGTGTGGGGGTGAAGG + Intronic
935789953 2:106581917-106581939 CGTTGTGTGTGTGGGGGGGCGGG - Intergenic
936239834 2:110777786-110777808 CTGTGTGTATGTGGGGTTGAGGG + Intronic
938134982 2:128749514-128749536 CTCTGTGTATGTGTGTGTGCTGG + Intergenic
940166183 2:150775407-150775429 GGTTGTGCATGTGGGGGAGAAGG + Intergenic
941200159 2:162498480-162498502 CTCTGTGTGTGTGGGGGGGAGGG + Intronic
941927822 2:170913945-170913967 GGCTGAGTATGTGGGAGTGGTGG - Intergenic
945385423 2:209193696-209193718 CAGTGTGAGTGTGGGGGTGAGGG - Intergenic
946741897 2:222810695-222810717 GGCCGTGCATGTGTGGGTGAAGG + Intergenic
947510727 2:230752033-230752055 GGGTGTGTATGTGGGGGGGGGGG - Intronic
948964603 2:241367962-241367984 CTGTGTGTATGTGGGGGTGGAGG - Intronic
1173007555 20:39151699-39151721 TGGTGTTGATGTGGGGGTGAGGG + Intergenic
1174937472 20:54886885-54886907 TGCTGTATATGTGGGAGTTATGG + Intergenic
1175083748 20:56442389-56442411 GGCTGTGTTTTGGGGGGTGATGG - Intronic
1175373319 20:58507524-58507546 GGGTGTGTGTGTGGGGGTGTGGG - Intronic
1179414660 21:41188555-41188577 CCCTGGGTCTGGGGGGGTGATGG - Intronic
1180039030 21:45266360-45266382 CCCTGTGTGTGGGGTGGTGAGGG - Intronic
1180115797 21:45704171-45704193 CGCTGAGTGGGTGGTGGTGAAGG + Intronic
1180567781 22:16689974-16689996 CACTGTGCATGTGGTGATGAGGG + Intergenic
1180914556 22:19476575-19476597 CCCTGTGGATATGGGGGTGGGGG - Intronic
1180956059 22:19741871-19741893 AGCTGGGAATGTGGGGGTGTAGG + Intergenic
1181185697 22:21102140-21102162 GTGTGTGTCTGTGGGGGTGAAGG + Intergenic
1181498686 22:23302873-23302895 CCCTGTGTCAGTGGGAGTGATGG - Intronic
1182053246 22:27329258-27329280 CTCTGTGTATGTGGTGGGGGCGG - Intergenic
1182549204 22:31091881-31091903 AGCAGTGTATGTGAGGCTGACGG - Intronic
1182551764 22:31104571-31104593 GCGTGTGTATGTGGGGGGGAGGG - Exonic
1183796999 22:40127460-40127482 CTCTGTGTGTGTGTGTGTGAGGG - Intronic
1184217732 22:43078848-43078870 CCCCGTGTCTGTGGGTGTGAGGG - Intronic
1184217751 22:43078912-43078934 CCCCGTGTCTGTGGGTGTGAGGG - Intronic
1184217770 22:43078976-43078998 CCCCGTGTCTGTGGGTGTGAGGG - Intronic
1184217824 22:43079168-43079190 CCCCGTGTCTGTGGGTGTGAGGG - Intronic
1184918587 22:47590091-47590113 CACAGTGCATGTGGGGGTGGGGG - Intergenic
1184918610 22:47590215-47590237 CACAGTGCATGTGGGGGTGGGGG - Intergenic
1184918626 22:47590298-47590320 CACAGTGCATGTGGGGGTGGGGG - Intergenic
1184918635 22:47590340-47590362 CACAGTGCATGTGGGGGTGGGGG - Intergenic
1185417310 22:50717257-50717279 GGCTGTGTGTGTCGGGGTGGGGG + Intergenic
950419107 3:12886456-12886478 CACTGTGTATGGGGTGGTGGGGG - Intergenic
951930439 3:27960760-27960782 GGCTGTGTATGTGGCGGGGGAGG - Intergenic
954877528 3:53811882-53811904 CGCAGTGTATTTGGGGGAAAGGG - Exonic
955503103 3:59604637-59604659 CACTTTGTTGGTGGGGGTGAGGG - Intergenic
956126770 3:66018202-66018224 TCCTGTGTGTGTTGGGGTGAGGG - Intronic
956491281 3:69774708-69774730 CCCTGTGTATGTTGGGGTGTGGG + Intronic
956749995 3:72337688-72337710 TGGTGTGTGTGTGGGGGGGAGGG + Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957436957 3:80190046-80190068 CTCTGGGTTTGTGTGGGTGAGGG - Intergenic
959251658 3:103955964-103955986 AGCTGGGTATGTGTGGGTGGTGG + Intergenic
959347456 3:105217126-105217148 GGGTGTGTTTGTGGGGGTGGAGG - Intergenic
962129044 3:132652814-132652836 CAGTGTGTAGGTGGGGGTAAAGG + Intronic
962382602 3:134909749-134909771 CCCTGTGGAGGTAGGGGTGAAGG - Intronic
964682076 3:159352559-159352581 CTCTGTGTGTGTGTGCGTGATGG + Intronic
967232223 3:187350646-187350668 CCCTGTGTATGTGGGTGTAGGGG + Intergenic
968009040 3:195260967-195260989 GGCTGTGGGTGTGGGGATGAGGG - Intronic
968490686 4:889159-889181 CGCTGGGTACGTGTGGGTCAGGG - Intronic
972319002 4:37955333-37955355 CTCAGTGTATGTGGGGATGAGGG + Intronic
972685216 4:41346014-41346036 CTCTGGGTATGTGGGGGGAAGGG - Intergenic
973585298 4:52384381-52384403 AGATGTGAATTTGGGGGTGAGGG + Intergenic
977586724 4:98782551-98782573 CGCTTTGCATGTGAGGGGGAAGG + Intergenic
981249698 4:142585051-142585073 CACTGTGTGTGTGGTGGTGGGGG + Intronic
982978566 4:162100745-162100767 GGCTGTGCATGTGTGGGGGAGGG + Intronic
984117402 4:175698877-175698899 GGCAGTGTATGTAGGGGTGAGGG - Intronic
984501727 4:180566210-180566232 GGGTGTGAGTGTGGGGGTGAGGG + Intergenic
985416330 4:189739234-189739256 TGCTGTGTGTGTCTGGGTGAGGG - Intergenic
985504979 5:273683-273705 CGCTGTGGGTGGGGGGGTGCTGG + Intronic
985516103 5:345488-345510 ATGTGTGTATGTGGGGGGGAGGG + Intronic
985962724 5:3314929-3314951 TGTTGTTTATGTGGGGGTAAGGG - Intergenic
986098752 5:4585882-4585904 GCATGTGTGTGTGGGGGTGAGGG - Intergenic
986518200 5:8585196-8585218 CTCTGTGTATGTGTGTGTGGGGG - Intergenic
988179506 5:27771869-27771891 TGGTGTGTATGTGTGTGTGAGGG - Intergenic
992157188 5:73967098-73967120 AGTTGTGGATCTGGGGGTGAAGG + Intergenic
993500397 5:88660462-88660484 CGGTGTGTGTGTGGTGGTGGCGG + Intergenic
994639517 5:102389447-102389469 CTCTGTGTGTGTGGGGGTGGGGG - Intronic
998005101 5:138651529-138651551 CTCTGTGTGTGTGGGGGTGGGGG - Intronic
998399815 5:141842895-141842917 GGCTATGTGTGTGGGGGTGGGGG - Intergenic
999269631 5:150289328-150289350 CAGTGTGTATGTAGGGATGAAGG - Intronic
1001198249 5:169693007-169693029 GGGTGTGTGTGTGGGGGTGGGGG + Intronic
1001757962 5:174185497-174185519 CCAGGTGTATGTGGGGGTGGTGG + Intronic
1002058877 5:176614459-176614481 CTCTGTGTGTGGGGGGGGGAGGG + Intergenic
1002303650 5:178271290-178271312 TGAAGTGTATGTGGGGGTGAGGG - Intronic
1002346094 5:178548064-178548086 GGGTGTGTGTGTGGGGGTGAGGG - Intronic
1002394977 5:178945685-178945707 CTCTGTGTGTGGGGGGGTGTGGG + Intronic
1003777081 6:9379509-9379531 GGCTGTGTATGTGCGTGTGCTGG + Intergenic
1006801921 6:36765215-36765237 CGCAGTGGCTCTGGGGGTGAGGG - Intronic
1007445281 6:41900688-41900710 GGCTGTGAATGTGAAGGTGACGG - Intergenic
1007491109 6:42222770-42222792 TGCTGTGTACATGTGGGTGATGG + Intergenic
1010659238 6:78549679-78549701 CCATGTTTATTTGGGGGTGAAGG - Intergenic
1011130089 6:84043641-84043663 GTGTGTGTATGGGGGGGTGAGGG + Intronic
1015185118 6:130407153-130407175 CTATGTGAATGAGGGGGTGAGGG + Intronic
1016734809 6:147466350-147466372 GGCTGTGCATGTGTGGGTGCAGG + Intergenic
1017768507 6:157626579-157626601 GGCTGTGCATGTGGAGGGGAGGG - Intronic
1018379338 6:163243549-163243571 TGCTGTGTGTGTGGGCGTGTAGG - Intronic
1018812578 6:167308464-167308486 CCCTGTGGATGTGGGGGAGCAGG + Intronic
1019428746 7:988940-988962 CCCTGTGGGGGTGGGGGTGAGGG - Exonic
1020283445 7:6663543-6663565 GGATGTGGAGGTGGGGGTGATGG + Intergenic
1021268085 7:18549787-18549809 CTGTGTGTATGTGTGGGTGTGGG - Intronic
1021508319 7:21409306-21409328 TGCTTAGTATGTGGAGGTGATGG - Intergenic
1023346024 7:39271979-39272001 GGGTGTGTGTGTGGGGGTGGGGG + Intronic
1024144293 7:46496462-46496484 GGCTGTGAATGTGTGGGGGAAGG + Intergenic
1026167673 7:67924608-67924630 GGCTGTGTATGTGTGGGGGCTGG + Intergenic
1027137954 7:75638376-75638398 CGCGGTGGAGGTGGGGGTGGAGG + Intronic
1027341331 7:77211175-77211197 CGCTATGTTAGAGGGGGTGAAGG - Intronic
1029362959 7:100100616-100100638 CGCGGTGTCTCTGGGTGTGATGG - Intronic
1029629595 7:101742278-101742300 TGGTGTGTGTGTGAGGGTGAGGG + Intergenic
1029801368 7:102951087-102951109 GGCTATGTATGTGTGGGGGAAGG + Intronic
1030070268 7:105692275-105692297 TGCTGCACATGTGGGGGTGATGG + Intronic
1030503054 7:110384394-110384416 TGCTGTGTATGTGGGAGTAGTGG - Intergenic
1032086711 7:128887606-128887628 GGCTGTGTGTGGGGGGGTGTAGG - Intronic
1032515123 7:132501138-132501160 AGCAGAGTGTGTGGGGGTGAGGG + Intronic
1033151616 7:138919664-138919686 AGCTGTGTATGTGTGGGGGTGGG + Intronic
1033586684 7:142779595-142779617 TGGTGTGTGTGTGGGGGTGTGGG - Intergenic
1034221684 7:149451267-149451289 CACTGTGGGTGTGGGGGTGTGGG + Intronic
1034309986 7:150079029-150079051 CCCTGTGTATGTGGGGATGAAGG - Intergenic
1034796859 7:154021592-154021614 CCCTGTGTATGTGGGGCTGAAGG + Intronic
1035108908 7:156464198-156464220 GGCTGTGGATGTGGTGGGGATGG - Intergenic
1035142792 7:156780844-156780866 CACTGGGGAGGTGGGGGTGAAGG - Intronic
1035246355 7:157564844-157564866 TGCTGTGAATGTGGATGTGAGGG - Intronic
1037245330 8:16827989-16828011 GGCTGTGTCTGTGAGGGTGTTGG - Intergenic
1038122793 8:24636869-24636891 GGCTGTGAATGTGTGGGGGAAGG + Intergenic
1039257298 8:35733586-35733608 CTCTGTGTGTGTGGAGGTGATGG - Intronic
1039737109 8:40344820-40344842 CTCTGTGCATGTGGGGCTGGTGG + Intergenic
1039811835 8:41056089-41056111 CTCTGTGTGTATGGGGGTGTTGG - Intergenic
1039884873 8:41649149-41649171 CGCTGTGCCCCTGGGGGTGAAGG - Intronic
1039913206 8:41841092-41841114 CGCAGTGAATGTGGGGCTGCAGG - Intronic
1041768145 8:61442079-61442101 GGCTGAGTAGGTGGGGTTGAGGG - Intronic
1042100871 8:65273829-65273851 TGTTGTGTATTTGGGGGTCATGG - Intergenic
1042444341 8:68866710-68866732 TGGTGTGTGTGTTGGGGTGAGGG + Intergenic
1044305820 8:90639373-90639395 CTGTGTGTATGTGGGTGGGAGGG - Intronic
1045474522 8:102541795-102541817 CTCTGTGTATGTGTGGGAGGAGG + Intergenic
1045857353 8:106779951-106779973 AGCTGTGTGTGTGGGCATGAAGG - Intergenic
1046748034 8:117896967-117896989 AGCTGAGCAAGTGGGGGTGAAGG - Intronic
1046899791 8:119511596-119511618 GTCTTTTTATGTGGGGGTGAGGG - Intergenic
1047030213 8:120868972-120868994 CGCGGTGTATGAGTGGTTGATGG + Intergenic
1047172329 8:122505865-122505887 CACTTTGTATGGGGGAGTGAAGG - Intergenic
1047766371 8:127993262-127993284 CTCCGTGTCTGTGGGTGTGACGG - Intergenic
1048044752 8:130763057-130763079 GGCTGTGGATGTGGGGTTGAGGG + Intergenic
1049301720 8:141874137-141874159 CAGTGTGTAGGTGAGGGTGATGG + Intergenic
1049301734 8:141874192-141874214 CGGTGTATAGGTGAGGGTGATGG + Intergenic
1049301771 8:141874378-141874400 CAGTGTGTAGGTGAGGGTGATGG + Intergenic
1052526555 9:29626644-29626666 CCATGTGTATGTGGTGGGGAAGG - Intergenic
1057702064 9:97370515-97370537 ACCTGGGTGTGTGGGGGTGATGG - Intronic
1058099732 9:100905684-100905706 CTCTGTGTGTGTGGGGGGGGGGG + Intergenic
1058622686 9:106899939-106899961 TGCAGTGTATATGTGGGTGATGG - Intronic
1059397938 9:114050373-114050395 TGCTGTGGTTGTGGGGGTGTGGG + Exonic
1059621538 9:116011177-116011199 AGATGTGTGTGTGGGGGTGGGGG + Intergenic
1061580803 9:131534652-131534674 GGCTGTGCATGTGGGGGAGTGGG + Intergenic
1061925277 9:133803174-133803196 CCCTGCGTATGTGGAGATGAAGG - Intronic
1062710715 9:137973776-137973798 GGCTGAGTATGTGAGGCTGAGGG + Intronic
1062731474 9:138112571-138112593 GGCTGTGGAGGTGAGGGTGAGGG + Intronic
1185464336 X:346033-346055 CGCGGTGGAGGTGGGGGTGGGGG + Intronic
1185650199 X:1642089-1642111 CTCTGTGTGTGTGTGTGTGATGG + Intronic
1186166161 X:6828459-6828481 GGCTGTGCATGTGTGGGTGCTGG - Intergenic
1186619620 X:11224835-11224857 GGCTGTGTATGTTGGGAAGATGG + Intronic
1187281045 X:17859018-17859040 CTGTGTGTATGTGGGGGTGTGGG + Intronic
1187715477 X:22098158-22098180 CTGTGTGTATGTGAGAGTGAGGG + Intronic
1189382257 X:40510396-40510418 TGCTGTGTATGTGTGGATGTGGG - Intergenic
1191902207 X:66053271-66053293 CCCTGAGTATGTGGGGGTGGGGG + Intergenic
1192573388 X:72224069-72224091 CTCACTGGATGTGGGGGTGAAGG - Intronic
1192583491 X:72303220-72303242 AGGTGTATGTGTGGGGGTGAGGG + Intronic
1194143546 X:90235119-90235141 CTCACTGGATGTGGGGGTGAAGG - Intergenic
1195668798 X:107452230-107452252 TGATGTGTGTGTGGGAGTGAGGG + Intergenic
1195718479 X:107841812-107841834 CTCTGTGTAGGTGTGGGTGGAGG + Intronic
1195795332 X:108641597-108641619 CGGTGTGTATTTGGGAGAGAAGG - Intronic
1196609410 X:117694839-117694861 TGGTGTGTGTGTGGGGGGGAGGG - Intergenic
1197615292 X:128683758-128683780 AGCTGTGTGGGTGGGGCTGAGGG - Intergenic
1197735399 X:129847057-129847079 GGCTGTGTGTGTGGGGAGGAGGG - Intergenic
1198703362 X:139420475-139420497 TTCTGTGTGTGTGGGGGTGGGGG + Intergenic
1199738021 X:150703483-150703505 TACTGTGTGTGTGTGGGTGAGGG - Intronic
1199845389 X:151689028-151689050 CTCTGTGTGTGTGTGGGTGGGGG - Intergenic
1200045545 X:153398981-153399003 CCCTACGTGTGTGGGGGTGAGGG + Intergenic
1200056010 X:153461401-153461423 GGCTGTGTATGTGTGGGGCAGGG + Intronic
1200059975 X:153479835-153479857 CGCTCTGTCTGCAGGGGTGAGGG - Intronic
1200489299 Y:3804440-3804462 CTCACTGGATGTGGGGGTGAAGG - Intergenic