ID: 1158911947

View in Genome Browser
Species Human (GRCh38)
Location 18:62073199-62073221
Sequence GTGTGTAAGGGGGGGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 608
Summary {0: 1, 1: 0, 2: 1, 3: 51, 4: 555}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158911938_1158911947 22 Left 1158911938 18:62073154-62073176 CCATCAAATTATCAGGGGTGTGT 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG 0: 1
1: 0
2: 1
3: 51
4: 555

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158911947 Original CRISPR GTGTGTAAGGGGGGGATGGA GGG Intronic
900110683 1:1004250-1004272 GTGTGTGAGGGGGGTGTTGAGGG - Intergenic
900493417 1:2964731-2964753 GTGTATAGTGGGTGGATGGATGG - Intergenic
900725526 1:4214123-4214145 GTAGGTAAGGGAGGGAGGGAGGG - Intergenic
901678511 1:10900327-10900349 GTGTGTGTGGCGGGGATGGCAGG + Intergenic
901928763 1:12583625-12583647 GTATGTGAGGGAGGGATGGATGG - Intronic
902202695 1:14845484-14845506 ATGAGTAAGTGGGGGATGGATGG + Intronic
902230312 1:15023416-15023438 GTGGGTAGGAGGGGGAAGGAAGG + Intronic
902987022 1:20161092-20161114 CTGTGTGAGGAGGAGATGGAGGG + Intergenic
903407654 1:23111762-23111784 GTGTGTAAGGTGGGTGGGGAGGG - Intronic
903479657 1:23644130-23644152 TTGGGTAAGAGGGGGATGCAGGG - Intergenic
904052233 1:27646623-27646645 GGGTGTCAGTGGGTGATGGAGGG + Intergenic
904496362 1:30888995-30889017 GTGAGAAAGGGAGGGAAGGAGGG + Intronic
904586054 1:31581278-31581300 GTGGGTAGGGAGGGGATGGCCGG + Intronic
904814172 1:33182630-33182652 GTGTGTAAGGCGGTGAGGGGTGG + Intergenic
905869667 1:41396006-41396028 GTGGGTGAGGTGGGCATGGAGGG - Intergenic
906101897 1:43269319-43269341 CTGTGTAAGGGGCCCATGGAGGG - Intronic
906422989 1:45686608-45686630 GTGTGTAAGGCGGGGTCGGACGG - Exonic
906716822 1:47976253-47976275 GTGTGTAAGGGGTAGAAGGTTGG - Intronic
907470732 1:54671805-54671827 GTGAGTGTGGGGGAGATGGATGG + Intronic
907615503 1:55920719-55920741 CTGTGAAAGGGGGGGTGGGAAGG + Intergenic
907637221 1:56147641-56147663 GTGTGTGTGGGTGGGGTGGAGGG + Intergenic
907802055 1:57778887-57778909 GTGAGTAAGGGAAGGAGGGAGGG - Intronic
908389928 1:63675240-63675262 GTGTGGGAGGGGGAGAGGGAAGG - Intergenic
908999758 1:70204716-70204738 GTGTGTAAGAGAGAGAGGGAGGG - Intronic
909115021 1:71522714-71522736 GTGTGTAAGGGGGGGGTAGAGGG - Intronic
910356720 1:86365875-86365897 GTGTGTGAGCAGGGGGTGGAGGG - Intronic
910751821 1:90639058-90639080 GGGTGGAAGGGAGGGAGGGAGGG + Intergenic
910818729 1:91321652-91321674 GTGTGTACGTGTGGGATGGAGGG - Intronic
911669738 1:100593984-100594006 GTGTTCCAGTGGGGGATGGATGG + Intergenic
912058273 1:105632357-105632379 GTGGGTAAGGTGGGGAGGGAAGG - Intergenic
912212739 1:107572389-107572411 GTGTGTGCGGGGGAGGTGGATGG + Exonic
912544807 1:110443035-110443057 GTGTGTGAGGGTGGGAATGATGG + Intergenic
912727949 1:112075944-112075966 GTGGGTAAGGGATGGGTGGATGG + Intergenic
912793234 1:112674257-112674279 GTGTGTACGTGTGGGAGGGAGGG - Intronic
913106155 1:115615912-115615934 CTGTGTATGGTGGGGGTGGATGG + Intergenic
915048241 1:153038586-153038608 GTGTGTAGGGGAGGGAGGGAAGG - Intergenic
915102026 1:153507622-153507644 GAGTGGAAGGGAGGGATGGCAGG - Intergenic
915567146 1:156721515-156721537 GTGTGTCAGGGGGAGTTGCATGG + Intergenic
915925855 1:160019074-160019096 GTGTGTATGGGGGTGGCGGATGG - Intergenic
916187597 1:162148124-162148146 GAGTGTAATGGAGGGCTGGAAGG + Intronic
916406920 1:164506964-164506986 GTGGGTGAGAGGTGGATGGAAGG - Intergenic
917002602 1:170375944-170375966 GTGTGTGTGGGGGGGGTGGGGGG + Intergenic
917796709 1:178538099-178538121 GGGTGTGAGGGGGAGATGCAGGG + Intronic
918194902 1:182212122-182212144 TTGTGGAAGGTGGGGAAGGAAGG + Intergenic
918660479 1:187081843-187081865 GGGAGGAAGGGAGGGATGGAGGG - Intergenic
919542942 1:198873775-198873797 GTGTGTGTGGGAGGAATGGAAGG + Intergenic
919660688 1:200242295-200242317 GTGTGTCATGGATGGATGGATGG - Intergenic
919773953 1:201181579-201181601 GAGAGTAAGGGATGGATGGAAGG - Intergenic
919786500 1:201261600-201261622 GTGAGCAAGGGGGTGATGGTGGG + Intergenic
920076733 1:203342592-203342614 GGGTGGAAGTTGGGGATGGAGGG + Intronic
920113162 1:203601180-203601202 GTGTGGACTTGGGGGATGGATGG - Intergenic
920440651 1:205978539-205978561 GTGTTTGAGGGGTGGATGGGTGG + Exonic
920840562 1:209550365-209550387 GTGGGGAAGAGGGGGCTGGAAGG - Intergenic
922039897 1:221886547-221886569 GTGTGAAAGAGAGGGAAGGAGGG + Intergenic
922124632 1:222711077-222711099 GTGTGTCGGGGGCGGATGGGGGG + Intronic
922127062 1:222738038-222738060 GTGTGTGTTGGGGGGATGGAGGG + Intronic
922157505 1:223051779-223051801 ATGTGTAAGGGTGGAAGGGAAGG + Intergenic
923051784 1:230395107-230395129 GAGTGTGAGGGGAGGAGGGAGGG - Intronic
923212962 1:231822437-231822459 GTGAGTAAGAGGGGAATGGGAGG + Intronic
923365628 1:233258333-233258355 GAGTCTAAGGTGGGGAAGGAAGG - Exonic
924268612 1:242308934-242308956 GTGTGGGAGGGGAGGATGGAAGG + Intronic
924382942 1:243480589-243480611 GGGTGGATGGGTGGGATGGATGG + Intronic
924728682 1:246692670-246692692 GGGAGTAAGGGAGGGAGGGAGGG - Intergenic
924728694 1:246692698-246692720 GGGAGTAAGGGAGGGAGGGAGGG - Intergenic
1062831465 10:608486-608508 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
1063350813 10:5352937-5352959 CTGTGTGTGGGGAGGATGGAGGG - Intergenic
1063392341 10:5658825-5658847 GTGGGGAAGGGAGGGATAGAAGG + Intronic
1063929126 10:11011407-11011429 GTGGGTGAGGGGGAGAGGGAAGG + Intronic
1064686439 10:17867067-17867089 GAGGGCAAGGGGGGAATGGAGGG - Intronic
1065021669 10:21507100-21507122 GTGTGTATGTGGGGGGTGGGAGG - Intergenic
1065021893 10:21508566-21508588 GTGTGTAAGAGGGAGAGAGAGGG + Intergenic
1065074856 10:22067029-22067051 GTGTGACAGTGGGGGATGGGTGG - Intergenic
1065728770 10:28691712-28691734 GAGTGGAGAGGGGGGATGGAGGG - Intergenic
1066716293 10:38289834-38289856 GTGTGGGAGGGGAGGATGGAAGG - Intergenic
1067295979 10:44975418-44975440 GGGTGGAAGGTGGGGATGGGAGG - Intronic
1067570083 10:47365178-47365200 GGGTGTGAGGAGGAGATGGAGGG - Intergenic
1067800101 10:49352873-49352895 GGGAGTGAGGGAGGGATGGAGGG + Intergenic
1067809795 10:49417891-49417913 GTGGGTGGGGGGGAGATGGAGGG - Intergenic
1067915031 10:50388093-50388115 TTGTGTAAGAGAGGGAAGGAAGG + Intronic
1068627413 10:59264190-59264212 GGGTGGAAGGGAGGGAAGGAGGG + Intronic
1068764869 10:60752026-60752048 GTGTGTGTCGGGGGGATGGGGGG - Intergenic
1069819793 10:71220343-71220365 GTGGGTAAGAAGGGGAAGGATGG + Intronic
1070649843 10:78227243-78227265 TTGTGGAATGAGGGGATGGATGG + Intergenic
1070775720 10:79108644-79108666 GTGTATTAGGGGGTGATGGTTGG - Intronic
1071132448 10:82410530-82410552 GTGGCTAAGGGGTGGAGGGAAGG + Intronic
1071145494 10:82565490-82565512 GTGTGTTTGGTGGGGATTGAAGG - Intronic
1071476835 10:86032376-86032398 GAGTGTAAGGGGGGGAAGTGTGG + Intronic
1071601027 10:86958815-86958837 GTGGGTAAGTGGGGCATGGCAGG + Exonic
1072888139 10:99298187-99298209 CTGTGTAAGGGAGGAAGGGAAGG - Intergenic
1073059543 10:100725074-100725096 GTGTGTATGGGGGAGGGGGAGGG - Intergenic
1073371372 10:102992618-102992640 GTGTGTAAAGGGGGACTGGGAGG + Intronic
1073426630 10:103459062-103459084 GTGTGGGAGGGAGGGAGGGAGGG + Intergenic
1074206278 10:111285768-111285790 GTGTGTAAAGAGGGGTGGGAGGG + Intergenic
1074881708 10:117664832-117664854 GTGTGCCAGGGGAGGAGGGATGG - Intergenic
1075561445 10:123471534-123471556 ATGTGGAAGGGTGGGAGGGAGGG - Intergenic
1076120516 10:127933244-127933266 GTGTGTATGGAGGGGGTGGTAGG - Intronic
1076292535 10:129358152-129358174 GTGTGTGTGGGGGGGGTGGGGGG + Intergenic
1076334445 10:129696060-129696082 GTGTGTCATGGGGGGAGGCAAGG + Intronic
1077310298 11:1885716-1885738 GTGAGTACTGGGTGGATGGAGGG - Intronic
1077789636 11:5424511-5424533 CTGTGTACTGGGAGGATGGAGGG - Intronic
1078088921 11:8251726-8251748 GTGTGTATGGGGGGGGTATAGGG + Intronic
1078306718 11:10195381-10195403 GTGAGTAAACTGGGGATGGAAGG + Intronic
1079134607 11:17769314-17769336 GGTTGGAAGGGAGGGATGGAGGG + Intronic
1079333637 11:19552887-19552909 GTGTGTGTGGGGGGGAAGGGGGG + Intronic
1079391159 11:20023272-20023294 GTGTGTGAGTGGGGGTGGGAGGG + Intronic
1080457531 11:32430056-32430078 GAGTGCAAGGGAGGGAAGGAGGG + Intronic
1081614673 11:44583555-44583577 GTGTGGAAGGGTGGGACGGTGGG + Intronic
1081914265 11:46720641-46720663 GTGGGGAAGGGGTGGATGGGTGG - Intronic
1083682312 11:64357277-64357299 GTGTGGACAGGGGGGATGGCTGG + Exonic
1084147385 11:67272262-67272284 GAGGTCAAGGGGGGGATGGAGGG + Intronic
1084192415 11:67505064-67505086 GGGTGCGAGTGGGGGATGGAGGG - Intronic
1084457987 11:69279431-69279453 GTGTGTAAGTGATGGATGGATGG - Intergenic
1084693672 11:70741375-70741397 GAATGTATGGGTGGGATGGATGG - Intronic
1084735195 11:71100905-71100927 GAGGGCAAGGGAGGGATGGACGG + Intronic
1084786013 11:71442041-71442063 CTGGGTAAGGAGGGAATGGATGG - Intronic
1085186730 11:74582055-74582077 ATATGCAAGGTGGGGATGGAAGG + Intronic
1085369936 11:75992582-75992604 GTGGGAAAGAGGGGGATGGCTGG + Intronic
1085539902 11:77257536-77257558 GTGTGTAGGAGAGGGAGGGAGGG - Intronic
1085622783 11:78050035-78050057 GTGTTTGAGTGAGGGATGGATGG + Intronic
1085645197 11:78218268-78218290 GTGTGGATGGGGGTGATGCAGGG - Exonic
1085670303 11:78457962-78457984 GTGTGTAACGGGGGCTTGGAAGG + Intronic
1085844509 11:80049968-80049990 GAGTGGAAGGGAGGGAGGGAGGG + Intergenic
1086237636 11:84651196-84651218 GTGTTTAAAGGGGAGATGAAGGG - Intronic
1086738873 11:90341806-90341828 GTGTGTAAGGGAGGAAGAGAGGG + Intergenic
1086903942 11:92397708-92397730 GTTCGCAAGCGGGGGATGGAAGG - Intronic
1088247969 11:107837901-107837923 GTGTATAAGGTGGGGGTGGGTGG - Intronic
1088967591 11:114739358-114739380 GTGAGTGAGGGAGGGAGGGAGGG - Intergenic
1089270816 11:117300252-117300274 GTGTGTAAGGTGGAGAGGGGAGG - Intronic
1089298698 11:117484937-117484959 GTGTGTAAGTGGGGCTGGGAGGG + Intronic
1089410774 11:118240716-118240738 GTGTGTCTGCGGGGGATGGAAGG - Intronic
1089588065 11:119522533-119522555 TTTTGGAAGGTGGGGATGGATGG + Intergenic
1090224986 11:125064325-125064347 GGGTGTGAGGGGGGAATGGAGGG - Intronic
1091060016 11:132452476-132452498 GTGAGGAAGGGAGGGAGGGAGGG - Intronic
1091087161 11:132732634-132732656 GTGTGTAAGGGGAGGCTTCAGGG + Intronic
1091763221 12:3101514-3101536 GTGTGTAGGCTGGGGATGGGAGG - Intronic
1092100621 12:5880888-5880910 ATGGGTAGGTGGGGGATGGATGG + Intronic
1092272835 12:7037164-7037186 GTGTGTTGGCGGGGGAGGGAGGG + Intronic
1093503849 12:19841826-19841848 GTGTGTGTTGGGGGGATGTAGGG + Intergenic
1093795491 12:23305202-23305224 GGGAGGAAGGGAGGGATGGAGGG - Intergenic
1095500289 12:42830166-42830188 GTGTGTCAGGGGTGGGTGGGTGG + Intergenic
1096481306 12:51942922-51942944 GTGTGTGAGAAGGGGGTGGATGG + Intergenic
1097227762 12:57488567-57488589 GTGTGTTAGGAGGGGAGAGAGGG - Intronic
1097246868 12:57611756-57611778 CTGTGGGAGGGGGGGAGGGAGGG - Intronic
1099198222 12:79645023-79645045 GTGTGTGTGGTGGGGGTGGAGGG - Intronic
1100926859 12:99558449-99558471 GTGTGTCAAGGGGGGAGGGGAGG + Intronic
1101952410 12:109187051-109187073 GTGAGGAAAAGGGGGATGGAGGG + Intronic
1102037930 12:109782839-109782861 GTGGGGAAGGTGGGGGTGGAGGG - Intergenic
1103190334 12:118995866-118995888 GTGGATAAAGGGTGGATGGATGG - Intronic
1103485868 12:121282252-121282274 GTGGGGAAGGAGGGGCTGGAAGG + Intronic
1104080895 12:125429862-125429884 GTGTGGAAAGGGGGGAAGCAGGG - Intronic
1104778459 12:131404863-131404885 ATGGGTGAGGGGTGGATGGATGG - Intergenic
1104896210 12:132166274-132166296 GTGGGTGATGGGTGGATGGATGG - Intergenic
1104896411 12:132167062-132167084 GTGGGTGATGGGTGGATGGAAGG - Intergenic
1104910978 12:132240912-132240934 GTGTGTAATGGGGATAGGGAGGG - Intronic
1104911064 12:132241182-132241204 GTGTGTAATGGGGATAGGGAGGG - Intronic
1104911261 12:132241767-132241789 GTGTGTAATGGGGATAGGGAGGG - Intronic
1105309041 13:19190096-19190118 TTGTGGAAGGGAGGGAGGGAGGG + Intergenic
1105514668 13:21078320-21078342 GTGAGGAAGGGAGGGAGGGAGGG + Intergenic
1106002600 13:25738337-25738359 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
1107127221 13:36858633-36858655 GTGTGTAAGGGTGCTCTGGAAGG - Intronic
1110333566 13:74300481-74300503 GTGTGGTAGGGGTGGGTGGATGG + Intergenic
1112050284 13:95638613-95638635 GTGTATAAGGGGGGTAGTGATGG - Intronic
1112251135 13:97781722-97781744 CTGGGTCAGGGGAGGATGGAAGG + Intergenic
1112447373 13:99476574-99476596 GTGTGTGGGGGGGGGGTGGCGGG - Intergenic
1112503159 13:99957373-99957395 GTGTGTGTGGGGGGGGTGGTAGG + Intergenic
1112657788 13:101470676-101470698 GTGTGTGTGGGAGGGGTGGAGGG + Intronic
1113934045 13:113984100-113984122 GTGAGTCATGGGTGGATGGATGG - Intronic
1113934123 13:113984470-113984492 GTGAGTGATGGGTGGATGGACGG - Intronic
1113934130 13:113984497-113984519 GTGAGTAATGGGTGGATGGACGG - Intronic
1113934137 13:113984524-113984546 GTGAGTGATGGGTGGATGGATGG - Intronic
1113934146 13:113984555-113984577 GTGAGTGATGGGTGGATGGATGG - Intronic
1113934200 13:113984798-113984820 GTGAGTGATGGGTGGATGGATGG - Intronic
1113934398 13:113986098-113986120 GTGAGTCATGGGTGGATGGATGG - Intronic
1113934456 13:113986390-113986412 GTGAGTGATGGGTGGATGGACGG - Intronic
1113934463 13:113986417-113986439 GTGAGTAATGGGTGGATGGACGG - Intronic
1113934479 13:113986475-113986497 GTGAGTGATGGGTGGATGGATGG - Intronic
1113934742 13:113988088-113988110 GTGAGTCATGGGTGGATGGATGG - Intronic
1113934800 13:113988380-113988402 GTGAGTGATGGGTGGATGGACGG - Intronic
1113934807 13:113988407-113988429 GTGAGTAATGGGTGGATGGACGG - Intronic
1113934814 13:113988434-113988456 GTGAGTGATGGGTGGATGGATGG - Intronic
1113934823 13:113988465-113988487 GTGAGTGATGGGTGGATGGATGG - Intronic
1113934882 13:113988733-113988755 GTGAGTGATGGGTGGATGGATGG - Intronic
1113934998 13:113989283-113989305 GTGAGTAATGGGTGGATGGACGG - Intronic
1113935034 13:113989440-113989462 GTGAGTGACGGGTGGATGGACGG - Intronic
1113935086 13:113989673-113989695 GTGAGTGACGGGTGGATGGATGG - Intronic
1114494558 14:23123715-23123737 GGGAGTAAGGGGGTGGTGGAGGG - Intergenic
1114620647 14:24094331-24094353 GTATGGAAGGCGGGGAAGGAGGG - Exonic
1115212736 14:30984130-30984152 GTGTGTGGGGGGGGGTTGGGGGG - Intronic
1117448438 14:55827448-55827470 CAGTGTAACGGGTGGATGGAAGG - Intergenic
1118182591 14:63508090-63508112 GTGTGTGGGGGTGGGAAGGAGGG - Intronic
1118771709 14:68946734-68946756 GAGACTAAGTGGGGGATGGATGG - Intronic
1119644322 14:76337548-76337570 GTGTGTGGGCGGGGGCTGGATGG + Intronic
1119847787 14:77843450-77843472 GTGATTAAGGGGCAGATGGAGGG + Intronic
1121173616 14:91874211-91874233 GTGTGGGAGGTGGGGCTGGATGG - Intronic
1121333330 14:93061503-93061525 GTGAGAAAGGAGGGGAGGGAGGG + Intronic
1121781562 14:96625373-96625395 GTGTGTGAGGGGAGGATGAGGGG - Intergenic
1121798383 14:96754120-96754142 GTGTGGAAGGGGGAGAGGGAAGG + Intergenic
1121843489 14:97154134-97154156 GTGAGGAAGGGAGGGAGGGAGGG - Intergenic
1121843682 14:97155250-97155272 GTGTGTGTTGGGGGGATGGCAGG + Intergenic
1122870354 14:104635501-104635523 GTCTGGAAGGTGGGGAAGGAAGG + Intergenic
1123114822 14:105889933-105889955 GTGTGTAAGTGGTGGCAGGAAGG + Intergenic
1123432112 15:20226786-20226808 GTGTGTGAGGGGTGGAGGGGGGG - Intergenic
1123929440 15:25155443-25155465 GGGTGGAAATGGGGGATGGAAGG + Intergenic
1124395693 15:29299866-29299888 ATGAGTAGGTGGGGGATGGATGG + Intronic
1125077097 15:35632424-35632446 GTGAGGAAGTGAGGGATGGAAGG + Intergenic
1126173466 15:45713355-45713377 GGGAGGAAGGGAGGGATGGAGGG - Intergenic
1126436902 15:48645864-48645886 GAGTGGAAAGGGAGGATGGATGG - Intergenic
1127670228 15:61187941-61187963 GTGTGTTAGGGGAGGGTTGAGGG - Intronic
1128227295 15:66011035-66011057 GTGTGTAAAGGGGGTCTGGCAGG + Intronic
1128283434 15:66416343-66416365 GTGTGTTTGGGGGGGATTGTAGG - Intronic
1128611780 15:69079793-69079815 GGGTGGAAGGGGTGGAAGGAGGG - Intergenic
1128868835 15:71136845-71136867 GTGTGTAAGGGGCGGCAGAATGG + Intronic
1129193833 15:73952808-73952830 GGGTGTGAGTGGGAGATGGAGGG + Intergenic
1129385615 15:75194630-75194652 GTGTGGAGGGAGGGAATGGATGG + Intergenic
1130530498 15:84744408-84744430 CTGTGGAGGGGTGGGATGGAAGG - Intergenic
1130573110 15:85066567-85066589 GTGTGTTTTGGGGGGATGGTGGG - Intronic
1131177580 15:90219712-90219734 GTGTGGAAGGGGGGGCTCGGCGG + Intronic
1131431458 15:92392535-92392557 GTGTGTAAGGAGGGGCAGGAGGG - Intergenic
1131588591 15:93722585-93722607 GTGCGTATTGGGGGGATGTATGG + Intergenic
1131744122 15:95427363-95427385 GTGTGTATATGGGGGATAGATGG - Intergenic
1132045178 15:98557625-98557647 GTGTGTAATGGCGGGGTGGGGGG + Intergenic
1133399454 16:5473952-5473974 GTGGGTGATGGGTGGATGGATGG + Intergenic
1133567565 16:7009128-7009150 GTGAGGGAGGGAGGGATGGAGGG - Intronic
1134206618 16:12243368-12243390 GTGTGTAAGAGAGGAATGGCAGG - Intronic
1134803562 16:17106733-17106755 GTGAGTAGGGGGAGGATGGGAGG + Exonic
1134904230 16:17965954-17965976 GTGTGTATGTAGGGGATGGGAGG - Intergenic
1135166825 16:20146486-20146508 GTATGGAAGGGGAGGAAGGAGGG + Intergenic
1135205644 16:20481578-20481600 GTGGGGAAGTGGGGGATGAAGGG + Intronic
1135213268 16:20542235-20542257 GTGGGGAAGTGGGGGATGAAGGG - Intronic
1136103508 16:28012237-28012259 GTGTTTAAGGGGTGGTGGGAGGG - Intronic
1136449627 16:30346429-30346451 GTGTGTAAGCCGGGGAAGGCTGG + Intergenic
1136593054 16:31229249-31229271 GTGTGGGAGGGAGGGAGGGAAGG + Intergenic
1136692787 16:32047788-32047810 GTGTGTGTGGGGGGGGTGGTTGG + Intergenic
1136793283 16:32991013-32991035 GTGTGTGTGGGGGGGGTGGTTGG + Intergenic
1136852526 16:33624353-33624375 GTGTGTGAGGGGTGGAGGGGGGG + Intergenic
1137481675 16:48856965-48856987 GTGTGCATGGGGAAGATGGAAGG + Intergenic
1138454892 16:57115580-57115602 GGGTGTGGGGTGGGGATGGAGGG - Intronic
1139318048 16:66090213-66090235 GTGTGTATGGGGAGAATGAAGGG + Intergenic
1139963604 16:70732419-70732441 GTGTGCAAGGGAGGTCTGGAAGG - Intronic
1140932999 16:79645081-79645103 GTGTGTGGGAGGGGGATGGGGGG + Intergenic
1141588159 16:85048971-85048993 GTGTGTGAGAGGGAGAGGGAGGG + Intronic
1141916006 16:87097571-87097593 GTGTGTCAGGGGGGGCGGGGGGG + Intronic
1142128624 16:88422275-88422297 GTGGGTAATGGATGGATGGATGG + Intergenic
1142226826 16:88881609-88881631 GAGAGTAAGGGGGTGAGGGAGGG + Intronic
1203095542 16_KI270728v1_random:1252704-1252726 GTGTGTGGGGGGGGGGTGGTTGG + Intergenic
1203114126 16_KI270728v1_random:1472821-1472843 GTGTGTGAGGGGTGGAGGGGGGG + Intergenic
1142536964 17:624943-624965 GTGAGGAAGGGAGGGAGGGAGGG - Intronic
1142622160 17:1172077-1172099 GTGTGTGTGGGGAGGAAGGAAGG + Intronic
1143007316 17:3845723-3845745 GTGAGTGAGGAGGGGCTGGAAGG - Intronic
1143395079 17:6587947-6587969 GTCTGTAAGTGGGGGTGGGAGGG + Intronic
1143526724 17:7477493-7477515 GTGTGTACGTGGGGGAAGGGAGG - Intronic
1143703542 17:8680347-8680369 GGGTGTAATTAGGGGATGGAGGG + Intergenic
1145737453 17:27242985-27243007 GTGGGTAGGGGTGGGATGGGTGG - Intergenic
1147387387 17:40090442-40090464 GTGTGGAAGGAGGAGGTGGATGG - Intronic
1147426926 17:40350344-40350366 GTGTGTATGGGGGGGTGGAAGGG + Intronic
1147924511 17:43938415-43938437 GTGAGGAAGGGAGGGAGGGAGGG + Intronic
1148105246 17:45115300-45115322 GTGGGGAAGGGGGGGAAGGTGGG - Intronic
1148397329 17:47319595-47319617 GTGGGAAAGCGGGTGATGGAGGG + Intronic
1148588722 17:48799513-48799535 ATGTGAAATGAGGGGATGGAGGG - Intronic
1149344246 17:55718190-55718212 GTGTGTAAGGGTGGGATAAATGG + Intergenic
1149448964 17:56734644-56734666 GTGAATAAGGGAGGGAGGGAAGG + Intergenic
1149895067 17:60422652-60422674 GGGTGTGAGGGAGGGAGGGAAGG + Intronic
1150250540 17:63702012-63702034 GTGTGTGGGGGGGGGAGGGCGGG + Intergenic
1150293133 17:63993176-63993198 GAGGGTAAGGGAGGGAAGGAAGG + Intergenic
1150553235 17:66230427-66230449 GTTGGTATGGGGAGGATGGAAGG - Intronic
1151288993 17:73134942-73134964 GTGTGGAAGGGGAAGATGGCTGG + Intergenic
1151680162 17:75618974-75618996 GTGGGGCAGGGAGGGATGGAGGG - Intergenic
1151833332 17:76568658-76568680 GTGTGTAAAAGGGGGAAGGAAGG + Intronic
1152240285 17:79157355-79157377 CTGTGGAAGGGGTGCATGGACGG - Intronic
1152262228 17:79273414-79273436 GTGTTTTAGGGTGGGGTGGATGG + Intronic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1154961146 18:21309895-21309917 GTGTGTGGGGAGGGGATGGGGGG - Intronic
1155158999 18:23180833-23180855 GTCTGTGGTGGGGGGATGGAGGG + Intronic
1155308862 18:24504682-24504704 GTGTGGAGGGCGGGGAGGGAAGG + Intergenic
1155379871 18:25208539-25208561 GGGTTTAAGGGAGGGAGGGAAGG - Intronic
1155407003 18:25500125-25500147 GAGTGGAGGGGTGGGATGGAGGG + Intergenic
1156261060 18:35445337-35445359 GTGTGTATTGTGGGGAGGGAGGG + Intronic
1156522891 18:37736542-37736564 GTATGTGAGGGGGGAAAGGAAGG + Intergenic
1157099817 18:44719344-44719366 GTGTGCAAGGGGTGGAGGGCAGG + Intronic
1157495575 18:48154746-48154768 GTGGGAAAGGTTGGGATGGAGGG - Intronic
1157730703 18:50001700-50001722 GTGTGTAAGGGAGTGATCTAGGG - Intronic
1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG + Intronic
1159448975 18:68575984-68576006 GTGTGTAGGGGGGTGTGGGAGGG - Intergenic
1159598497 18:70406224-70406246 GTGAGAAATGGGGAGATGGAGGG + Intergenic
1159893065 18:73971385-73971407 GTGTGTAAGAGGGAGATACAAGG - Intergenic
1160173253 18:76571870-76571892 GTGAGAAAGAGGGGGATGGGAGG + Intergenic
1160960054 19:1716785-1716807 GTGTGTGGGTGGGGGATGAACGG + Intergenic
1160977714 19:1802079-1802101 GTGGGTGAGGGGTGGATGGGTGG - Intronic
1161139637 19:2639812-2639834 GAGGGTAAGGGAGGGAGGGAGGG + Intronic
1161657613 19:5525602-5525624 GTGTGTGATGGATGGATGGATGG - Intergenic
1161657652 19:5525793-5525815 GTGAGGGAGGGGAGGATGGATGG - Intergenic
1162112052 19:8404639-8404661 CTGTGGCAGGGAGGGATGGAAGG + Intronic
1162168124 19:8768289-8768311 GGGAGTGAGGGGGGGATGGAGGG - Intergenic
1162966040 19:14156559-14156581 GTGTGTGTGGGGGGGGTGGGGGG + Intronic
1163667414 19:18609900-18609922 ATGTGTAAGGGGCAGAAGGAGGG + Intronic
1164467588 19:28500902-28500924 GTGTGGAAGCGAGGCATGGAGGG - Intergenic
1164579054 19:29423065-29423087 GAGTGTCAGGGAGGGAGGGAAGG - Intergenic
1164790572 19:30974242-30974264 GTGTGTAAGATGGAGGTGGAGGG - Intergenic
1164835738 19:31354069-31354091 GTGTTTAAGGTGGCGATTGAGGG + Intergenic
1165482396 19:36072360-36072382 GTGTGTCCGGGGAGGATGGTGGG + Intronic
1166092021 19:40515474-40515496 GTGTGGAAGGGAAGGATGGGAGG - Intronic
1166663227 19:44661124-44661146 GTGTGTCAGACAGGGATGGAGGG - Intronic
1167087641 19:47321052-47321074 GTGTGTGTGGGGGGGGTGGGGGG - Exonic
1167618050 19:50547030-50547052 GTGTATAAGTGGGGGAAGGATGG + Intronic
1167651151 19:50729692-50729714 GGGAGTGAGGGGGGGAGGGAAGG + Intergenic
1168279051 19:55294248-55294270 GTGAGTGAGGGGCGGATAGAGGG + Intronic
1168343965 19:55641483-55641505 GTGTGTAACAGGGAGAGGGATGG + Intronic
1168501790 19:56899192-56899214 GTGTGTGGGGTGGGGATGAAGGG + Intergenic
925200030 2:1959671-1959693 GTGTGTGAGGGGCAGAGGGATGG - Intronic
925283439 2:2700941-2700963 GAGGGGAAGGGGAGGATGGAGGG - Intergenic
926209134 2:10856132-10856154 GTGTGTTGGGGGGGGGTGGTGGG + Intergenic
926781237 2:16473995-16474017 GTTTGTAAGGGGTGGAAGGAGGG + Intergenic
926857588 2:17273541-17273563 GTGTGAAGGGGTGGGATGGAAGG - Intergenic
929078774 2:38101090-38101112 GTGTGTATGTGGGGGTGGGAGGG + Intronic
929687496 2:44047231-44047253 GAGTGAAGGGGGAGGATGGATGG + Intergenic
929932450 2:46269462-46269484 GTGTGTGAGGTGGGGGTGGGTGG - Intergenic
930083805 2:47477908-47477930 GTGTGGGAGGGAGGGAGGGAAGG - Intronic
930236553 2:48894440-48894462 GTGGTTAAGGGATGGATGGATGG - Intergenic
930288093 2:49459388-49459410 TTGTGAAAGGGAGGGAAGGAGGG + Intergenic
930365420 2:50433692-50433714 GTGAGAAAGGGAAGGATGGAAGG + Intronic
930683189 2:54279681-54279703 GTGTGTGAAGTGGGGAGGGAGGG - Intronic
931121644 2:59226437-59226459 GGGTGGAAGGGAGGGAGGGAGGG + Intergenic
931152315 2:59587990-59588012 GAGAGGAAGGGAGGGATGGAGGG + Intergenic
931348881 2:61470947-61470969 GCGGGGAAGGGGGGGAAGGACGG + Intergenic
931757818 2:65389390-65389412 GTGTGTTGGGGGAGGAAGGAGGG + Intronic
932326320 2:70864347-70864369 CTGTGTGAGGAGTGGATGGAAGG - Intergenic
932348123 2:71008902-71008924 GTGTGTCAGTGTGTGATGGAGGG - Intergenic
932493934 2:72137496-72137518 GTGTGTGAGTAGGGGCTGGAAGG - Intronic
933562477 2:83905727-83905749 GGGTTTAAGGGGAGGAGGGAAGG + Intergenic
933820186 2:86104190-86104212 AGGTGTAAGGGGAGGGTGGAAGG + Intronic
934676606 2:96253813-96253835 GTGTGTAAGCAGGGGGTGGCTGG + Exonic
935315979 2:101834220-101834242 GGGAGGAAGGGAGGGATGGAGGG - Intronic
936339326 2:111617474-111617496 GTGTGTATGGGGGGGAGGGGAGG - Intergenic
936501104 2:113067081-113067103 GCTTGTAATGGAGGGATGGATGG + Intergenic
936997377 2:118429725-118429747 ATGTGTAAGGGGTGGATGGCAGG + Intergenic
937089607 2:119197061-119197083 GGGGGTGAGGGGAGGATGGAGGG + Intergenic
938119984 2:128626443-128626465 GTGTGCAAGGGGGAGATGTGGGG - Intergenic
940154697 2:150643197-150643219 GTGTGCTGGGGGAGGATGGAGGG - Intergenic
941200161 2:162498484-162498506 GTGTGTGTGGGGGGGAGGGTGGG + Intronic
941225187 2:162839046-162839068 GTGTGTTAGGGGGAGAGGGCGGG - Intergenic
944503586 2:200386827-200386849 GTGTATGAGAGGGGGATGGAGGG - Intronic
944605542 2:201348625-201348647 GTGTGTAAGGGGGTGGTGGGGGG - Intronic
946219920 2:218217403-218217425 GTGGGTAAGGGAGGCAAGGACGG - Exonic
946296468 2:218787675-218787697 GTGGGTATGGTGGGGAGGGAGGG - Intronic
946395993 2:219444086-219444108 GTGGGAAAGGGGGGGATGCGGGG - Intronic
946673910 2:222136721-222136743 GTGTGTGATGGAGGGAGGGAGGG + Intergenic
946697983 2:222380744-222380766 GTGTGAGAGGGAGGGATTGAAGG + Intergenic
948210541 2:236189956-236189978 GGGTGGAAGGGGTGGCTGGAGGG + Intergenic
948675194 2:239592922-239592944 ATGTGTAATCGGGGCATGGATGG + Intergenic
948675213 2:239593001-239593023 ATGTGTAATCGGGGCATGGATGG + Intergenic
948675231 2:239593080-239593102 ATGTGTAATCGGGGCATGGATGG + Intergenic
948675250 2:239593159-239593181 ATGTGTAATCGGGGCATGGATGG + Intergenic
948675268 2:239593238-239593260 ATGTGTAATCGGGGCATGGATGG + Intergenic
948675305 2:239593396-239593418 ATGTGTAATCGGGGCATGGATGG + Intergenic
948741890 2:240053779-240053801 GTGTGGACGGTGGGGACGGAAGG - Intergenic
1169530159 20:6476517-6476539 GTGTGTGGTGGGGGGATGGGTGG + Intergenic
1169689795 20:8317516-8317538 GTGTGTGTCGGGGGGATGGGGGG - Intronic
1169922774 20:10753174-10753196 GTGTGAGAGAGGGGGATAGAGGG + Intergenic
1169978234 20:11354451-11354473 GTGTGTAGCTGGGGGATGGCTGG - Intergenic
1170329011 20:15187976-15187998 GTGTGTAGGGGATGGATGGAGGG - Intronic
1170416876 20:16153035-16153057 GAGAGAAAGGGAGGGATGGAGGG + Intergenic
1170550801 20:17474462-17474484 GGGTGCAAGGGAGAGATGGAGGG - Intronic
1170840887 20:19924053-19924075 GTATGAAAGTGGGGTATGGAAGG - Intronic
1171321840 20:24252582-24252604 GTGTTTTTGGGGGGGATGCAGGG - Intergenic
1171937326 20:31287304-31287326 GTGTGGAATGAGGGGATGGATGG - Intergenic
1172107084 20:32523206-32523228 GGGTGGAAGGGGAGGATAGAAGG + Intronic
1172423958 20:34842391-34842413 CTGTGAAAGGAGGGGAAGGAAGG + Intergenic
1172649526 20:36493033-36493055 GTGGGTAGGGTGGGGATGGGGGG - Intronic
1173354618 20:42275558-42275580 GTATGGAAGTGGGGTATGGAAGG + Intronic
1173381951 20:42553369-42553391 GAGTGGAAGGGGGAGATAGAAGG - Intronic
1173653776 20:44684775-44684797 GTGTGTGGGGGGGGGAGGGGAGG + Intergenic
1173675931 20:44835775-44835797 GTGTGTATGTGGGGGGTGGGGGG - Intergenic
1174306881 20:49619577-49619599 ATGTGTGGGTGGGGGATGGATGG + Intergenic
1174506332 20:51020071-51020093 GGGGGCAAGGGAGGGATGGAGGG - Intronic
1174617093 20:51843964-51843986 CTGTGCAAGGGAGGGAAGGATGG - Intergenic
1175278554 20:57787950-57787972 GGGTGAAGGAGGGGGATGGAGGG + Intergenic
1175353378 20:58342801-58342823 CTGGGTGAGGGGGGAATGGAAGG + Intronic
1175829197 20:61952819-61952841 ATATGTAAGAGGGAGATGGAGGG - Intergenic
1176372868 21:6073139-6073161 GTGTGTTGGGGGGGGGTGGGGGG - Intergenic
1176546205 21:8201316-8201338 GGGTGTAGGGTGGGGATGGAGGG + Intergenic
1176565156 21:8384362-8384384 GGGTGTAGGGTGGGGATGGAGGG + Intergenic
1177408599 21:20701612-20701634 GTGTGTTCGGGGGGGGTGGGGGG - Intergenic
1178150089 21:29784445-29784467 GTATGTATATGGGGGATGGAGGG - Intronic
1178916866 21:36709664-36709686 GTGTGCAAGGGGCGCAAGGACGG + Intronic
1179185524 21:39082858-39082880 GTGTGGAAGGCGGGGCCGGAGGG - Intergenic
1179392143 21:41003668-41003690 GTGTGTTGGGGGGGGAGAGAGGG + Intergenic
1179750609 21:43465104-43465126 GTGTGTTGGGGGGGGGTGGGGGG + Intergenic
1180022570 21:45137738-45137760 GTGAGGAAAGTGGGGATGGAAGG + Intronic
1181049429 22:20231588-20231610 GGGTGTAAGTGGAGGAGGGAGGG - Intergenic
1182472509 22:30557213-30557235 GGGTGTAGGTGGGGGAGGGATGG - Intronic
1182741658 22:32572293-32572315 GGGAGTAAGGGAGGGAAGGAAGG - Intronic
1183263504 22:36811561-36811583 GTGTGGCAGGGAGGGAGGGAGGG + Intronic
1184293390 22:43509676-43509698 GGGATGAAGGGGGGGATGGATGG - Intergenic
1184567608 22:45301554-45301576 GTGGGCAGGGGTGGGATGGAGGG - Intergenic
1184917421 22:47579731-47579753 GTGTGTCGGCGGGGGTTGGAGGG - Intergenic
1185288682 22:50013603-50013625 GTGTGTGGGGGGGGGATGGCGGG + Intergenic
1203251077 22_KI270733v1_random:117553-117575 GGGTGTAGGGTGGGGATGGAGGG + Intergenic
949741603 3:7240694-7240716 ATGTGGAAGAGGGGGAGGGAAGG - Intronic
949995336 3:9612108-9612130 GTGTGGGGGGGGGGGATGGGGGG + Intergenic
951614210 3:24523166-24523188 GTGTGTGGGGGGGGGAGGGTGGG + Intergenic
952647693 3:35681507-35681529 GTGTGTAAAGGGGGTGTGGATGG + Intronic
953500239 3:43426099-43426121 GTGTGGAGGCGGGGGAGGGATGG - Intronic
953574151 3:44099385-44099407 GTGTGTGTGGAGGGGAGGGATGG + Intergenic
953660994 3:44891496-44891518 GTGTGTAGAGGAGGGAGGGAGGG - Intronic
953934160 3:47025247-47025269 GTGAGTAAGGGAGTCATGGATGG - Intronic
954288480 3:49636389-49636411 GTGTGTATGGGGAGGGTGCAGGG + Intronic
954420758 3:50417901-50417923 GTGTGTACGTGGGGAATGAATGG + Intronic
954986147 3:54794326-54794348 GTGTGAAAGGGGGGCATTGCAGG - Intronic
956038332 3:65119699-65119721 GTGTGGTGTGGGGGGATGGAGGG + Intergenic
956960379 3:74392382-74392404 GGGTGGAAGGGAGGGAGGGAGGG - Intronic
961323822 3:126097926-126097948 CTGTGTAAGGGGGAGACAGAGGG - Intronic
961380772 3:126495291-126495313 ATGTGGAATGGGGAGATGGATGG - Intronic
961617915 3:128198137-128198159 GTAGGCAAGGGGGGGATGAAAGG + Intronic
962170242 3:133094227-133094249 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
962203247 3:133416577-133416599 GTGAGTATAGGGGAGATGGAAGG - Intronic
962329006 3:134461088-134461110 GTGTGTGTGGGAGGGAAGGAAGG - Intergenic
962894731 3:139704151-139704173 GTGGGTAAGGTGGGGGAGGAGGG + Intergenic
963534704 3:146513157-146513179 GTGAGGAAGGGGGAGAAGGAGGG - Intergenic
965486010 3:169279359-169279381 TTGTGTAGTGGGGGGAAGGAGGG - Intronic
966495551 3:180576427-180576449 GTGGGTGTGTGGGGGATGGAAGG - Intergenic
966947683 3:184788744-184788766 GTTTGTAAGAAGGGGAAGGAAGG + Intergenic
967273069 3:187746594-187746616 GTGTGTGTGGGGGGGAGGGTGGG + Intergenic
967467759 3:189827355-189827377 GTCTGTAAGGGGGAGCTGGTGGG - Intronic
968931226 4:3580529-3580551 GTGGGTGGGGGGGTGATGGATGG - Intronic
968959796 4:3737703-3737725 GTGTGAGAGGAGGGGCTGGAGGG - Intergenic
969596080 4:8149961-8149983 GAGGGTAAGGGGGGAAGGGAGGG - Intronic
970250464 4:14110125-14110147 GTGTCTAAATGGGGCATGGAGGG - Intergenic
970740755 4:19234959-19234981 GTGTGTGAAGGGAGGAAGGATGG - Intergenic
970828079 4:20302460-20302482 ATGTCTATGGGGGGGATGGAAGG + Intronic
971137566 4:23886424-23886446 GTTGGTAAGGGGAGGATGGGGGG + Intronic
973110351 4:46390199-46390221 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
973555919 4:52082950-52082972 ATGTGTATGGAGGGGAGGGATGG + Intronic
975337457 4:73195872-73195894 GTGTATATGGGTGGGATGGGAGG + Intronic
975472529 4:74786706-74786728 GTGTCTAAGTTGGGGAGGGAAGG - Intronic
977555908 4:98487144-98487166 GGGAGGGAGGGGGGGATGGAGGG + Intronic
979004301 4:115270702-115270724 GTGTGTAAAAGAGAGATGGAGGG + Intergenic
979981335 4:127258913-127258935 GTGAGTAAGGGGATAATGGAAGG - Intergenic
980650899 4:135713734-135713756 GAGTGGGAGGGAGGGATGGAGGG - Intergenic
981344077 4:143655008-143655030 GTGTGGAAATGGAGGATGGAGGG - Intronic
981405954 4:144369347-144369369 GTGTGTGAGGTTGGAATGGAGGG - Intergenic
982882009 4:160731690-160731712 GGGAGGAAGGGAGGGATGGAGGG - Intergenic
983382681 4:167017546-167017568 GGGTGTAAGGTGGGCATGGCTGG - Intronic
983566898 4:169162939-169162961 CTGGGTAAGGAGAGGATGGAGGG - Intronic
985574195 5:665947-665969 GTGAGCAGGGCGGGGATGGAAGG - Intronic
985728854 5:1533298-1533320 ATGTGTAGGGGTGGGATGTAGGG - Intergenic
985888036 5:2695388-2695410 GGGTGAAAGGGAGGGATGCAAGG + Intergenic
986034940 5:3928257-3928279 GTGTGTAGGGGGAGGCGGGAGGG - Intergenic
986251486 5:6062193-6062215 GGGTGTGAGGTGGGCATGGAAGG - Intergenic
990247251 5:53875112-53875134 GTGTGAAAGGAGGGGAAGAAAGG - Intergenic
991404183 5:66285675-66285697 GTGTGTAAGGAGCGGATGGTTGG + Intergenic
992792761 5:80228220-80228242 GTGAGTGAGGGAGGGAGGGAGGG + Intronic
992939047 5:81743800-81743822 GTGTGTAAGGGAGTGATGCTGGG + Intronic
993204599 5:84863367-84863389 GTGAGAAAGGGAGGGAGGGATGG - Intergenic
993683344 5:90907490-90907512 GTGAGAAAGGGAAGGATGGAAGG - Intronic
996105262 5:119494172-119494194 ATGTGTGATTGGGGGATGGATGG + Intronic
996106519 5:119510936-119510958 CTCTGTAAGTGGGGGCTGGATGG - Intronic
996198887 5:120645376-120645398 GTGTGTGGGGGGGGGATGGGTGG - Intronic
996213969 5:120845179-120845201 GTGTGTATGGGGAGGAAGAAGGG + Intergenic
996308900 5:122080306-122080328 GAATGTATGGGGGGGATGGGGGG - Intergenic
997875555 5:137543655-137543677 GTGTGTAAGGAGAGGAGGGTAGG + Intronic
998152782 5:139766487-139766509 CTGTGTATGGGGGAAATGGATGG + Intergenic
998957386 5:147452422-147452444 GTGTGTAGTGGGGGAATGGGTGG - Intronic
999181955 5:149676092-149676114 GTGTGTAGGGCGGGTATGGCAGG + Intergenic
999452111 5:151686270-151686292 TTGTGTATTGGGGGGACGGAAGG + Intronic
999943201 5:156567276-156567298 GTGTGGAGGGGGTGAATGGATGG + Intronic
1001299639 5:170524358-170524380 GTGTGGAAGGGAGGAATGCAAGG + Intronic
1001569426 5:172720374-172720396 TTGTGGAAGGGAGGGAGGGAAGG + Intergenic
1001722867 5:173870783-173870805 GTGTGGTAGGGGGGCATAGAGGG + Intergenic
1002172948 5:177385571-177385593 GTGTGTGTGGTGAGGATGGAGGG + Intronic
1002304618 5:178275869-178275891 GTGTTTAAGGGGATCATGGAGGG - Intronic
1002437461 5:179240402-179240424 CTGGGTAAGGGGTGGAGGGAAGG + Intronic
1003062865 6:2876181-2876203 GGGGGTAAGGGGGGGATGGGGGG - Intergenic
1004080389 6:12386756-12386778 GTGTGTGTGGGGGGGGTGGTGGG + Intergenic
1004193633 6:13486240-13486262 GTGTGGGGGGGGGGGATGGGGGG - Intronic
1004193637 6:13486244-13486266 GTGTGTGTGGGGGGGGGGGATGG - Intronic
1004886726 6:20058410-20058432 ATGTGTAGGGGAGGGATGGGGGG + Intergenic
1006273706 6:32984108-32984130 GTTTGTAAGGGGTGGATGGGTGG + Intergenic
1006902299 6:37511039-37511061 GACTGGAAGGAGGGGATGGAGGG - Intergenic
1007335659 6:41153545-41153567 GTGTGGAAGGGGGAAAGGGATGG + Intronic
1007394539 6:41570063-41570085 GTGTGTCAGGGGGTGGTGGGGGG - Intronic
1008680748 6:53869286-53869308 GTGTCAAAGAGGGGGATGGTGGG + Intronic
1009632779 6:66220553-66220575 GGAAGGAAGGGGGGGATGGAGGG - Intergenic
1010045021 6:71431774-71431796 GAGAGGAAGGGAGGGATGGAAGG - Intergenic
1012443803 6:99288399-99288421 GTGTGTAAGGGTGGTATGGTAGG + Intronic
1012790101 6:103682408-103682430 GTGTGTAGGGGGGTGGGGGAAGG - Intergenic
1013000014 6:106012619-106012641 GTGTGTAGGGGGGTAATGTATGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014290378 6:119551329-119551351 GTGAGCAAGGGGAGGATGGAAGG - Intergenic
1014911923 6:127104851-127104873 GTGTGTGTGGTGGGGAGGGAGGG - Intergenic
1015688838 6:135897294-135897316 GTGTGTAGGCGGAGGAAGGAGGG + Intronic
1015982950 6:138857441-138857463 GTGTGGGAGGTGAGGATGGAGGG - Intronic
1017203833 6:151784115-151784137 GTGTGGAAAGGGGGTAAGGAAGG - Intronic
1017213359 6:151881035-151881057 GTGTGGGAGGCGGTGATGGAAGG + Intronic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1018044792 6:159956198-159956220 GTGAGTGAGGGAGGGAGGGAAGG + Intergenic
1018228834 6:161656291-161656313 GTGTGAGAGGCGCGGATGGATGG - Intronic
1018302491 6:162418658-162418680 GTGTTGAGGGGGGGGATGGCTGG + Intronic
1018962259 6:168457347-168457369 GTGTTGAAGGTGGGGTTGGATGG - Intronic
1019103463 6:169650304-169650326 GGGTGGATGGAGGGGATGGAGGG - Intronic
1019209985 6:170397297-170397319 GAGAGTGAGGGAGGGATGGAGGG - Intronic
1019510491 7:1415222-1415244 GTGAGGGAGGGAGGGATGGATGG + Intergenic
1019549561 7:1595207-1595229 GAGTGGATGGGAGGGATGGATGG - Intergenic
1019638972 7:2092556-2092578 GTGTGTGAGGGGAGGATGCTCGG - Intronic
1019914665 7:4125054-4125076 ATGGGTAATGGGTGGATGGATGG + Intronic
1019968853 7:4523961-4523983 GGGAGGGAGGGGGGGATGGAGGG + Intergenic
1021209316 7:17826220-17826242 TTGTGTATGGAGGGGATGGAGGG - Intronic
1022103454 7:27182671-27182693 GTGTGCAAGAGAGGGATGCATGG - Exonic
1022186189 7:27971757-27971779 ATGTGTATGGTGGGGGTGGAAGG + Intronic
1022194731 7:28053849-28053871 GTGGGAAAGGTGAGGATGGAAGG - Intronic
1022547619 7:31203398-31203420 ATGTGGAAGGGAGGCATGGAGGG + Intergenic
1022629497 7:32071477-32071499 GGGTGAAAGGGAGGGAGGGAGGG - Intronic
1025615320 7:63112822-63112844 GTGTGTTTGGGGGGGTTGGGGGG + Intergenic
1026529485 7:71184918-71184940 GTGAGGAAGGGAGGGAGGGAGGG - Intronic
1026881547 7:73909533-73909555 GGGTGTAAGGGGGAGATTCAGGG - Intergenic
1027024565 7:74841570-74841592 GTGTGGATGAGGGGGAAGGATGG - Intronic
1027063200 7:75102552-75102574 GTGTGGATGAGGGGGAAGGATGG + Intronic
1027581000 7:79995662-79995684 GTGTGGTAGGGGGAGAGGGAAGG - Intergenic
1027667985 7:81062817-81062839 GTGTGCAAGAGGGGGTAGGAAGG - Intergenic
1028214453 7:88114443-88114465 GTGTGTCTGGAGGTGATGGATGG + Intronic
1028845767 7:95478269-95478291 GTGTGTAACTGGGTGAGGGATGG + Intergenic
1029003311 7:97179710-97179732 GTGTGTAGGGGGGGTAGGGGTGG - Intronic
1030149662 7:106390947-106390969 GTGTGTATTGGGGGGATAAAGGG + Intergenic
1031028805 7:116712689-116712711 GTGTGTGTGGGGGGGACGGGAGG - Intronic
1031898274 7:127379846-127379868 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
1033542392 7:142369031-142369053 GTGTGTGGGGGAGGGAGGGAAGG + Intergenic
1034416373 7:150966378-150966400 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
1034915991 7:155039417-155039439 GTGTGTGTGGGGGGGAGGGGAGG + Intergenic
1035960816 8:4135374-4135396 GTGGGAAAGAGGGGGAAGGAAGG + Intronic
1036206059 8:6806376-6806398 GTGTGAAGGGTGGGGATGGAGGG + Intergenic
1036243365 8:7096972-7096994 GTGTGTAAGTGGGAAATGGTGGG + Intergenic
1037584146 8:20264926-20264948 GTGTGGAAAGGGGGGATGTGGGG + Intronic
1038682665 8:29683775-29683797 GTGTGGAAGAGTGGAATGGATGG + Intergenic
1038832282 8:31074789-31074811 GTGGGTAAGAGAGGAATGGAAGG + Intronic
1038869875 8:31482152-31482174 GTGTGTATGGGGGGGTTGGGAGG + Intergenic
1040349465 8:46549688-46549710 GGGAGGAAGGGGGGGAGGGAGGG + Intergenic
1040532971 8:48280867-48280889 GTGTGGAATGGGTGGGTGGATGG - Intergenic
1040866673 8:52054987-52055009 GTGTGTAGGGGGGAAATGCATGG - Intergenic
1041230731 8:55748540-55748562 GTGTGCAAGGGAGAGAGGGAGGG + Intronic
1041474341 8:58247419-58247441 GTGTGTCAGGGGGGGCGGGGTGG - Intergenic
1041687018 8:60653175-60653197 GTGTGTGAGGGAGGGAGGGCTGG + Intergenic
1042041366 8:64594101-64594123 GTGTGTATGTGGGGGGTGGGTGG + Intronic
1043363491 8:79503375-79503397 GTGGGAAAGGGGGGGATGTATGG - Intergenic
1043602044 8:81952549-81952571 GGGAGTAAGGGAGGGAGGGAGGG - Intergenic
1043783210 8:84362957-84362979 GTCTGAAAGGGGGAGATTGAAGG + Intronic
1043789644 8:84448183-84448205 GTGTGGAAGGGTGGGCTGGAGGG - Intronic
1044715134 8:95093116-95093138 GAGTGTAAGGGGTGGGTGGGAGG + Intronic
1044818966 8:96143373-96143395 GTGGGGAAGGGAGGGATGAAAGG - Exonic
1045686117 8:104714005-104714027 GTGGGTAGGGGTGGGATGGCAGG + Intronic
1047221439 8:122921670-122921692 GTGAGGAAGGGAGGGAGGGAGGG + Intronic
1047235549 8:123039231-123039253 GTGTGTATGGAGGGGGTTGAAGG - Intronic
1047754438 8:127907820-127907842 GGTTGTAAGGAGGGGATGGTTGG + Intergenic
1048008833 8:130440662-130440684 GAGTGTAAGGGAGAGATGGGGGG - Intronic
1048294366 8:133203359-133203381 GTGTGTGATGGGCGGGTGGAGGG + Intronic
1048454794 8:134567921-134567943 GTGTGTAGGGGGCCTATGGAGGG - Intronic
1048810100 8:138277829-138277851 GTGTGTATTGGAGGGATGCATGG - Intronic
1049258476 8:141626256-141626278 ATGAGGAAGGGGTGGATGGATGG + Intergenic
1049464572 8:142744955-142744977 ATGGATAAGTGGGGGATGGATGG + Intergenic
1050131988 9:2422432-2422454 CTGTGTCAGGGAGGGCTGGAAGG + Intergenic
1050507971 9:6366873-6366895 GGGAGTAAGGGAGGGAGGGAGGG + Intergenic
1050539334 9:6656709-6656731 GTGGGGAAGGAGGGAATGGAGGG + Intergenic
1050802045 9:9627536-9627558 CTCTGTAAGGTGGGGCTGGAGGG + Intronic
1050931340 9:11330886-11330908 ATGTGTCTGGTGGGGATGGAGGG - Intergenic
1051191659 9:14519082-14519104 GTGTGTATGGTGGTGATGGTGGG + Intergenic
1052617519 9:30860781-30860803 TTGTGTAATGGATGGATGGATGG + Intergenic
1052781942 9:32790507-32790529 GTGTGTCAGGGGGTGAAGTAGGG - Intergenic
1054953161 9:70876640-70876662 GAGTGTAAGGGTGAGATGGTGGG - Intronic
1057142291 9:92734864-92734886 GTGGGCACGGGTGGGATGGAGGG - Intronic
1057479504 9:95433759-95433781 GGGTGGAAGGGAGGGAGGGAAGG - Intergenic
1057519720 9:95751575-95751597 CTGTGGAAGGGAGGGAGGGAGGG + Intergenic
1058125034 9:101182232-101182254 GGCTGGAAGAGGGGGATGGATGG + Intronic
1059521125 9:114943234-114943256 GTGTGTATGTGTGGGAGGGAGGG + Intergenic
1059541636 9:115136273-115136295 GTGTATGTTGGGGGGATGGAGGG + Intergenic
1060101885 9:120847920-120847942 GGGTGTAAGGGAGAGAGGGAAGG - Intergenic
1060942154 9:127548984-127549006 GTGTGTAAGCAGAGGCTGGAGGG + Intronic
1060952522 9:127612861-127612883 GGGTGAAAGAGGGGGAAGGAGGG - Intronic
1061318700 9:129814410-129814432 GTGTGTATGGGATGGATGGGAGG - Intronic
1061372983 9:130208214-130208236 GTGTGTGAGGTGGGGGTGGGGGG + Intronic
1061472481 9:130837340-130837362 GTGCCTAAGGCGGGGATGAATGG + Intronic
1061493505 9:130959131-130959153 GGGTGCAAGAGGGGGAAGGAGGG - Intergenic
1061618179 9:131793866-131793888 GTGTGTGAGGTGGCCATGGATGG + Intergenic
1061640332 9:131949264-131949286 TTGTGAAAGGGGAGGATGGCGGG + Intronic
1061930277 9:133828822-133828844 GTGTGGAAGGCGAGGCTGGAGGG - Intronic
1062201657 9:135306103-135306125 GGGGGTAAGGGAGGGAGGGAGGG - Intergenic
1203467482 Un_GL000220v1:100820-100842 GGGTGTAGGGTGGGGATGGAGGG + Intergenic
1186150454 X:6669349-6669371 GTATGTAAGGTTGGGATGGATGG + Intergenic
1186312552 X:8336333-8336355 GTGTTTAAAGTGGGGGTGGAGGG + Intergenic
1186439269 X:9571234-9571256 CTGTGTATGGGTGGGGTGGAGGG + Intronic
1186641781 X:11463247-11463269 GTGTGGAGAGGGAGGATGGAGGG + Intronic
1186683282 X:11898125-11898147 GTGTGTATTGGGGGTATGGGGGG + Intergenic
1186789077 X:12979404-12979426 GTGTGTATGGGGGGGAGGTGGGG + Intergenic
1187225039 X:17367583-17367605 GTGTGTGTGTGGGGGATGGGGGG + Intergenic
1187572230 X:20516440-20516462 GTGTGTGAGGGTGGGAAGGGAGG - Intergenic
1187607889 X:20906060-20906082 GTGTCTGTGGGGGGGATGCAGGG + Intergenic
1188125480 X:26363091-26363113 ATGTGTAAGGGAAGGAAGGATGG - Intergenic
1192534298 X:71914067-71914089 GTGTGGGAGATGGGGATGGAAGG + Intergenic
1192605776 X:72515582-72515604 GTGTGTGGGGGGGGGGTGGGGGG + Intronic
1192829404 X:74735569-74735591 GTGTGTGAGGGGGCTACGGAGGG - Exonic
1193416911 X:81236861-81236883 GTGTGTGAGGGAAGGACGGAGGG + Intronic
1194374122 X:93111334-93111356 GTGTGTAGGGGGGGGTGGGTGGG + Intergenic
1194592720 X:95819194-95819216 GTGTGTAAATGGGGGATAGATGG - Intergenic
1195036456 X:100974387-100974409 GTGGGGAAGGGAGGGAGGGAAGG - Intronic
1197614977 X:128680849-128680871 GTGTGTGTTTGGGGGATGGACGG - Intergenic
1198216236 X:134557105-134557127 GTGTGTGAGAGAGGGAGGGAGGG - Intergenic
1198441082 X:136663879-136663901 GTGTGAAAGTGTGGTATGGAAGG - Intergenic
1199435099 X:147804248-147804270 GTGAGTGAGGGGTGGGTGGAAGG + Intergenic
1200799089 Y:7369456-7369478 GTGTGTGGGTGGGGGATGAAGGG - Intergenic
1201476173 Y:14383856-14383878 GGGTGTGAGGAGGAGATGGAGGG - Intergenic
1201727620 Y:17170981-17171003 ATGTGCATGGGCGGGATGGATGG + Intergenic