ID: 1158919474

View in Genome Browser
Species Human (GRCh38)
Location 18:62174272-62174294
Sequence CAGTGAACTAGGAGCTACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158919474 Original CRISPR CAGTGAACTAGGAGCTACCA TGG (reversed) Intronic
900240581 1:1615581-1615603 CAGTGACCTAGGAGCGACTCGGG - Exonic
900789521 1:4670514-4670536 CGGTGAACTGGGAGCTTCCCTGG + Intronic
903273384 1:22206035-22206057 AAGTAAACAAGGACCTACCAGGG - Intergenic
909341441 1:74536004-74536026 CTGATTACTAGGAGCTACCATGG - Intronic
916494992 1:165338798-165338820 AACTGAACTTGGTGCTACCAAGG - Intronic
922126533 1:222731169-222731191 CAATGTAATTGGAGCTACCATGG - Intronic
922722178 1:227904753-227904775 GAGTGGTCCAGGAGCTACCAGGG - Intergenic
923511792 1:234659484-234659506 CAGTGGACTAGCTGCTCCCAGGG + Intergenic
924418506 1:243884699-243884721 CAATAAACTGGGAGCTAACAAGG - Intergenic
1066303458 10:34117156-34117178 CAGTGATGTGGGAGCTGCCAAGG - Intronic
1072517599 10:96201130-96201152 CACTGTACTAGGTGCTGCCAGGG + Intronic
1075433013 10:122405764-122405786 CAGTGGAGTAGAAGCCACCATGG + Intronic
1076041824 10:127256491-127256513 GAGTGAGCTTGGGGCTACCAGGG + Intronic
1076258340 10:129046073-129046095 CAGGGAACTAATAGCTAGCAGGG - Intergenic
1079156959 11:17956863-17956885 CACTAAACTAGGTGCTACCTTGG - Intronic
1080790901 11:35521646-35521668 CAGTAAAACAGGAGCTAGCAAGG + Intronic
1088574561 11:111257758-111257780 CACTGAACTAGGAGCAGACAAGG - Intronic
1089850112 11:121488317-121488339 AAGTGAAATAGTAGCTACAAAGG - Intronic
1092828087 12:12416042-12416064 CACAGAACTAGAACCTACCAAGG - Intronic
1093426119 12:19031333-19031355 CAGGGAAGTAGGAGGTACCCGGG - Intergenic
1093517432 12:20005242-20005264 CAGTGACATAGGAGATACAAGGG - Intergenic
1099625378 12:85066099-85066121 ATGTGTACTGGGAGCTACCAAGG + Intronic
1100649799 12:96572971-96572993 CACTGAATCAGGAACTACCAAGG + Intronic
1106200555 13:27533287-27533309 CAGTGAACTAGGGACGTCCAGGG + Intergenic
1109641652 13:65199524-65199546 CTGTGAAGTAAGAGCTATCATGG - Intergenic
1112896090 13:104302503-104302525 CAGTGTACTAGGAGCCTCCAGGG + Intergenic
1115995853 14:39194963-39194985 CAGTGAACTTGGAGTTAACTAGG - Intergenic
1116065105 14:39972267-39972289 GAATGAAGTAGAAGCTACCAAGG - Intergenic
1118363554 14:65075731-65075753 CAGTGAAGCAGCAGCCACCAGGG - Exonic
1118391305 14:65298114-65298136 CTGTGGAATAGGAGCCACCAAGG - Intergenic
1119433561 14:74583823-74583845 CACTGGACCAGGAGCTACCCGGG - Intronic
1121837151 14:97102335-97102357 AAGTGTCCTAGGAGCCACCAGGG + Intergenic
1125101507 15:35918445-35918467 CAGTAAAATAGGAATTACCAGGG + Intergenic
1125234577 15:37498189-37498211 TAGTGAACTAGAAGCTTACAAGG + Intergenic
1132076357 15:98824491-98824513 CAGAGAACAGGGAGCCACCATGG - Intronic
1143210330 17:5181942-5181964 CAGTGTAGTAGGACCTTCCAGGG - Exonic
1146152740 17:30489874-30489896 CAGAGTACTAGGAGGTACAAAGG + Intronic
1153255568 18:3166994-3167016 CTGTTAGCTAGGAGCTAGCATGG + Intronic
1155098602 18:22585454-22585476 CAGTAAACTAGGAGTTGGCAGGG + Intergenic
1156690100 18:39697314-39697336 GAGTGAACTAAGAGATACCCAGG + Intergenic
1157415941 18:47502888-47502910 CACTGGACTAGGTGCTACTAGGG + Intergenic
1158703390 18:59769856-59769878 CAGTGAACAGGGACATACCAGGG + Intergenic
1158919474 18:62174272-62174294 CAGTGAACTAGGAGCTACCATGG - Intronic
1159589301 18:70315321-70315343 AAGTGATCAAGGAGCTACCATGG - Intronic
1161852656 19:6745720-6745742 CAGAGACCTAGGAGATACCGGGG + Intronic
1163187668 19:15650340-15650362 CTGTGGACTAGCACCTACCAGGG + Intronic
1163511774 19:17739693-17739715 CAGTGGACTAAGAGGTAGCAAGG - Intergenic
1163706754 19:18818876-18818898 CAGTGAGCTAGGAGCTAGAATGG - Intergenic
1163978854 19:20879257-20879279 CAGTGAACTGGTTGCTACTATGG - Intergenic
1168343054 19:55636734-55636756 CAGGGCACCTGGAGCTACCACGG + Intronic
928813953 2:35266348-35266370 AAGAGAACTGGGAGCTAACAGGG - Intergenic
929591502 2:43150519-43150541 CAGAGGACTTGGAGCTACCCTGG + Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
930240098 2:48927457-48927479 CAGTGAACTAGGAGAAACTTTGG + Intergenic
931426636 2:62177693-62177715 CACTGAACTAGGAGATACAGTGG + Intergenic
934165645 2:89291815-89291837 CAGTGAAGTATGACCTTCCAGGG + Intergenic
934201632 2:89890641-89890663 CAGTGAAGTATGACCTTCCAGGG - Intergenic
936531772 2:113281178-113281200 CAGAGAATTAGGAAGTACCAAGG - Intergenic
941359206 2:164531190-164531212 CAGTGATCACTGAGCTACCAAGG + Intronic
1172105651 20:32515786-32515808 GGGTGAGCTAGGAGCTAGCAAGG + Intronic
1184112688 22:42404438-42404460 CAGCGAACCAGGGGCTCCCAGGG + Intronic
955028829 3:55196875-55196897 CAGGGAGCTAGGAGGAACCATGG + Intergenic
965507504 3:169532624-169532646 CAGTGGTCTAGGTGCTCCCAGGG - Intronic
965837704 3:172869529-172869551 CAGTGAAATAGGAGCCTCCAGGG - Intergenic
967714669 3:192748811-192748833 CAGAGAACTAGGAGTCAGCAGGG - Intronic
968292242 3:197547729-197547751 CAGTGAGCTAGGGGCCTCCAGGG - Intronic
970439534 4:16068129-16068151 CAGTGACATATGAGCCACCAGGG - Intronic
973097664 4:46223155-46223177 CAGAGAACCAGGAGCTTCAAAGG - Intergenic
974844625 4:67336538-67336560 CAGTGAACTATGATCCTCCAGGG + Intergenic
975011766 4:69364020-69364042 AAGTGGACTAGTAGATACCAGGG + Intronic
975812057 4:78179787-78179809 CACTGACATAGGAGCTACCCAGG + Intronic
975922293 4:79406817-79406839 AACTGCACTAGGAGCTGCCATGG - Exonic
977858897 4:101931461-101931483 CTGAGAACTAGGAGATCCCATGG - Intronic
979087374 4:116429532-116429554 CAGTGAACAAAGAGCTAGAAAGG - Intergenic
985773565 5:1827914-1827936 CCGTGAACTCGGAGCTCTCAGGG + Intergenic
987250985 5:16101146-16101168 CAGTCAAATAGGAGATAACATGG - Intronic
990985986 5:61641382-61641404 CAGCGAACTAGGCACTAACAGGG - Intronic
992326218 5:75662864-75662886 CAGTGACCTATGAATTACCAGGG + Intronic
992492188 5:77255858-77255880 CAGTGAACTGGCAGCTTCCAAGG - Intronic
995683699 5:114747799-114747821 CAATGAACCAGGAGCTTCCTTGG + Intergenic
999595855 5:153203381-153203403 CTGTGAACTAGGACCTAACATGG + Intergenic
1001514515 5:172346046-172346068 CAGTGAAGTAGGAGGTGACAGGG + Intronic
1002424941 5:179169448-179169470 CAGAGAACTAGGAGGCACTAAGG - Intronic
1003066301 6:2906081-2906103 CAGTGAACTTGGAGCTAGGAAGG - Intergenic
1003470861 6:6430274-6430296 CAGTGAAAGAGGAGCTACATGGG + Intergenic
1005873796 6:29996252-29996274 CAGTGAACCAGGAGCTACAAGGG - Intergenic
1008395740 6:51004576-51004598 CAGTGTTCTAGGAGCTGACAGGG - Intergenic
1013969262 6:115997356-115997378 CAGTGAACTTGGAGTTCCCATGG - Intronic
1021867158 7:24969869-24969891 CAGTGAACAAGGAGGTGACACGG - Intronic
1024797266 7:53035479-53035501 GAGGGGCCTAGGAGCTACCATGG - Intergenic
1026035225 7:66825613-66825635 CTGTGGACTAGGAGTGACCATGG + Intergenic
1026528019 7:71172640-71172662 CTGTGGAGTGGGAGCTACCAGGG + Intronic
1026984309 7:74545472-74545494 CTGTGGACTAGGAGTGACCATGG - Intronic
1028473696 7:91231514-91231536 CTGTGAACTAGGACCTACGATGG + Intergenic
1030185982 7:106762331-106762353 CAGTGAACTAGGGGCCAAGAAGG + Intergenic
1032115576 7:129114244-129114266 ATGTAAACTTGGAGCTACCAGGG - Intergenic
1032833565 7:135652724-135652746 CAGTGAAGTCGCAGCCACCAGGG + Intergenic
1038586862 8:28797512-28797534 TTGTGAACTAGGAACTCCCAGGG + Intronic
1039243471 8:35582252-35582274 CGGTGAAATAGGAGCTATCATGG - Intronic
1039919609 8:41883986-41884008 CAGGGAACTGGGAGATGCCAGGG + Intronic
1040664674 8:49618695-49618717 CAGTCAACTAGAAACTCCCAGGG + Intergenic
1043373095 8:79615285-79615307 CTGTGAGCAATGAGCTACCAAGG - Intronic
1046646973 8:116795839-116795861 CAGAGAACTAGAAGCTTTCATGG + Intronic
1047336581 8:123942147-123942169 CAGTTAAATAGTAGCTCCCAAGG - Intronic
1047424571 8:124733660-124733682 CAGTGAGGTAGGAACTCCCAAGG + Intergenic
1047791830 8:128211122-128211144 CAGTGAACTTGCAGCTAGCAGGG + Intergenic
1048601875 8:135927073-135927095 TAGTGAATTAGGAGGTAGCATGG + Intergenic
1059388518 9:113984149-113984171 CAATGAACTAGAAGCTACACTGG + Intronic
1061237932 9:129352852-129352874 CACTGAGCTAGGTGCTGCCAAGG - Intergenic
1185947941 X:4398714-4398736 CAGTAAACCAAGAGCTTCCATGG + Intergenic
1186157347 X:6739305-6739327 CAGTGACCTAGAAGCCATCAAGG + Intergenic
1193554030 X:82932037-82932059 CAGTGGGGTAGGTGCTACCAGGG + Intergenic
1195688404 X:107604841-107604863 TATTGCACTAGGGGCTACCAAGG - Exonic
1198012488 X:132572474-132572496 CTGTGAATCAGGAGCAACCAAGG + Intergenic
1198151870 X:133919075-133919097 CAGTGAACTAGGAGCAGAAATGG + Intronic