ID: 1158920443

View in Genome Browser
Species Human (GRCh38)
Location 18:62186576-62186598
Sequence GAGGTGGTCCTGCCTGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 269}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158920443_1158920452 6 Left 1158920443 18:62186576-62186598 CCACCCACAGGCAGGACCACCTC 0: 1
1: 0
2: 2
3: 33
4: 269
Right 1158920452 18:62186605-62186627 TGAGAAGTCGTGCTGTCGCTAGG 0: 1
1: 0
2: 0
3: 1
4: 53
1158920443_1158920454 30 Left 1158920443 18:62186576-62186598 CCACCCACAGGCAGGACCACCTC 0: 1
1: 0
2: 2
3: 33
4: 269
Right 1158920454 18:62186629-62186651 CTCCCGAGTGTGCAAGCATGTGG 0: 1
1: 0
2: 0
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158920443 Original CRISPR GAGGTGGTCCTGCCTGTGGG TGG (reversed) Intronic
900126492 1:1071104-1071126 GGGCTGGTCCTGCCATTGGGTGG - Exonic
900225254 1:1529958-1529980 GAGGTGGTGATGCCTGTGCGTGG - Intronic
900562788 1:3315912-3315934 GCGGTGGCCCTGCCTGCGGAAGG + Intronic
900740207 1:4326572-4326594 GAACTGGCCCTGGCTGTGGGAGG - Intergenic
902258633 1:15207224-15207246 GAGGAGGTCTTGCCAGTCGGAGG - Intronic
902400330 1:16153827-16153849 GTGGTGGGTCTGCCTGGGGGTGG - Intronic
902963574 1:19981587-19981609 GAGGCGGTTCTGCCTATTGGAGG - Intergenic
907410604 1:54280846-54280868 GATCTGTTCCTGCCTGTGGCGGG + Intronic
912421290 1:109543881-109543903 GTGGTTCTCCTGGCTGTGGGGGG + Exonic
912703833 1:111897446-111897468 GAGGTGCTTTTGCCTGTGTGGGG + Intronic
913274013 1:117120882-117120904 CAGGTGGACCTGCCCATGGGTGG - Exonic
914317464 1:146527687-146527709 GAGGTGGATCTGCCTGTTGGTGG + Intergenic
914428445 1:147599735-147599757 GAGGTGGTGCCGGCGGTGGGCGG + Intronic
914496892 1:148205673-148205695 GAGGTGGATCTGCCTGTTGGTGG - Intergenic
919760915 1:201097530-201097552 GAGCTGGTGCTCCCTGTGGGGGG - Intronic
919779672 1:201213803-201213825 GATGGGGTCCAGCCTGTGAGAGG + Intronic
921264247 1:213409351-213409373 GAGGTGGTTCTGACTGAGGAAGG + Intergenic
922729375 1:227941940-227941962 GAGGAGGTGATGCCTGTGGGAGG - Intronic
922750103 1:228066241-228066263 GAGGGGGTGGGGCCTGTGGGGGG - Intergenic
922785903 1:228282151-228282173 GAGGTGGTCTTCTCTGTGCGGGG + Exonic
923306654 1:232694591-232694613 TGCGTGGTCCTTCCTGTGGGGGG + Intergenic
923625021 1:235606760-235606782 GGGGAAGTCCTGGCTGTGGGAGG + Intronic
1062974339 10:1672462-1672484 GAGGTGGACCTTCCTGGCGGAGG - Intronic
1063959903 10:11298359-11298381 CAGGTGGTGCAGCCTGAGGGAGG + Intronic
1066041936 10:31557122-31557144 GTGGTGGTCATGCCTTTGTGTGG - Intergenic
1069054594 10:63831651-63831673 GAGGTGCTCCTACCTGTGAGTGG + Intergenic
1069390740 10:67931882-67931904 CCTGTGGTCCTACCTGTGGGAGG - Intronic
1069748786 10:70732626-70732648 GATGTGGCCCTGCCTTTGGGTGG + Intronic
1070994320 10:80762673-80762695 GATGTGGTGCTGTCTGTTGGTGG + Intergenic
1072377973 10:94837312-94837334 GAGGGGGTGCTGCCTTTGGTAGG + Intronic
1073067283 10:100770192-100770214 GAGGTGAGCATGCCTGTGGTGGG + Intronic
1074884732 10:117684958-117684980 GGGGTGGTGCTGCCTGCTGGGGG - Intergenic
1075162632 10:120037978-120038000 GAGATGGTCTTGACTGGGGGAGG + Intergenic
1075657770 10:124173419-124173441 GAGGTGGCCCCGGCTGTGGAGGG + Intergenic
1076546316 10:131247790-131247812 GAGGTGGTGCTGCTGGTGGTGGG - Intronic
1076919955 10:133446236-133446258 GTGGGGGCTCTGCCTGTGGGTGG - Intergenic
1077434038 11:2529953-2529975 GAGGTGCTCCTGTCAGTGAGGGG + Intronic
1077505466 11:2928113-2928135 GAGCTGCTGCTGCCTGTGGTGGG - Intergenic
1078466755 11:11555727-11555749 GAGGAGGTTCTGGCTGAGGGAGG - Intronic
1080433812 11:32221709-32221731 GAAGTGGCTCTGCCTGTGGGAGG + Intergenic
1080696524 11:34607685-34607707 GAGGTGGTAATGCCTGTGGTTGG - Intergenic
1081578078 11:44332183-44332205 GAGGTGCTTCTGAGTGTGGGAGG - Intergenic
1082173680 11:49036407-49036429 GTGGGAGTGCTGCCTGTGGGTGG - Intronic
1082608314 11:55269348-55269370 GTGGGGGTGCTGCCTGTGGGTGG - Intronic
1082657151 11:55869560-55869582 GAGGTGCACAGGCCTGTGGGGGG - Intergenic
1083617744 11:64034994-64035016 AAGATGTTCATGCCTGTGGGTGG - Intronic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1084420704 11:69059155-69059177 TTGGTGGTCCTGCCTTTGGAAGG + Intronic
1086692088 11:89799685-89799707 GTGGGAGTGCTGCCTGTGGGTGG + Intronic
1086696234 11:89849216-89849238 GTGGGAGTGCTGCCTGTGGGTGG - Intergenic
1086702293 11:89913173-89913195 GTGGGAGTGCTGCCTGTGGGTGG + Intronic
1086703874 11:89931277-89931299 GTGGGAGTGCTGCCTGTGGGTGG - Intergenic
1086709922 11:89995273-89995295 GTGGGAGTGCTGCCTGTGGGTGG + Intergenic
1086713711 11:90039971-90039993 GTGGGAGTGCTGCCTGTGGGTGG - Intronic
1086946475 11:92848841-92848863 GAGGTGGTGCTGCCTGAGCAAGG + Intronic
1087205865 11:95392940-95392962 AAGGTTTTCCTGCCTCTGGGAGG + Intergenic
1090249425 11:125241041-125241063 GAGGTGGTCCAGCATGGGGATGG - Intronic
1090387877 11:126367039-126367061 GTGGGGGGCCTGCCTGTAGGGGG + Intronic
1090948594 11:131452800-131452822 GTGCTGGTACTGCCTTTGGGTGG + Intronic
1093381970 12:18504035-18504057 TAGGTGCTCCTTCCTCTGGGTGG - Intronic
1093542706 12:20305863-20305885 GTGGTGGCCCTGGCTCTGGGTGG - Intergenic
1094831571 12:34302642-34302664 GTGCATGTCCTGCCTGTGGGGGG + Intergenic
1095501753 12:42847253-42847275 GAGGTATTCCTGTCTGTGGATGG + Intergenic
1095589834 12:43891023-43891045 GAGGTGGTCATGCATGTGGAGGG + Intronic
1096095308 12:48931403-48931425 GGGCTTGTGCTGCCTGTGGGTGG - Intronic
1096351950 12:50907980-50908002 GAGGGGGTACTGCCTTTGGTAGG + Intergenic
1098198941 12:68034565-68034587 GTGGTGGTTGTGCCGGTGGGAGG - Intergenic
1099512399 12:83554487-83554509 GAGGAGGACCTGGCTGTGTGAGG + Intergenic
1101753761 12:107605270-107605292 GATGTGGTCCTGCCCCTCGGAGG + Intronic
1104639014 12:130455507-130455529 TAAGTGGTCGTGGCTGTGGGAGG - Intronic
1104906588 12:132216658-132216680 GAGGTGTTCCAGCATCTGGGGGG + Intronic
1107018638 13:35729723-35729745 CAGGTGGTTCTGCTTGTGGGAGG + Intergenic
1107750234 13:43557459-43557481 GAGGAGCTCCTGCCTGGGAGAGG + Intronic
1109310444 13:60686676-60686698 GAGGTGATGATGCCTTTGGGAGG + Intergenic
1112200424 13:97268974-97268996 GAGGAGGGCCTGCCGGAGGGTGG + Intronic
1112585466 13:100715443-100715465 TTCGTGCTCCTGCCTGTGGGTGG + Intergenic
1112908996 13:104458859-104458881 TAGGTGAACCTGCCTGTGTGAGG - Intergenic
1113771325 13:112911127-112911149 GAGCTCGTCCTGGCGGTGGGTGG + Intronic
1114296427 14:21333649-21333671 CAGGTGGTCCTGGCTGTCAGTGG + Intronic
1114494984 14:23126288-23126310 GCGGTGGTGCTGGCTGTGTGCGG + Exonic
1117912090 14:60646529-60646551 GAGTTGGTTCTGCTTGTTGGAGG + Exonic
1118556777 14:67032353-67032375 GAGGTGCTGGTGCCTGTGTGTGG - Intronic
1118884193 14:69853007-69853029 CAGGTGTTCCTGCCTGGGGCAGG - Intergenic
1122117352 14:99534560-99534582 GAGGCAGTCCTGCCTCTGGGTGG - Intronic
1122770182 14:104094432-104094454 GGGGTGGTTCTGCCTGCAGGGGG - Intronic
1122825528 14:104368751-104368773 GAGGGGGTCCTGCATGTGGAGGG + Intergenic
1122909924 14:104822567-104822589 GAGGTGGCCATGCCTGTGAGAGG - Intergenic
1122913599 14:104845528-104845550 CAGGGGGTCCTCACTGTGGGTGG - Intergenic
1124378406 15:29143466-29143488 GAGGTGCTCCTTCCTGTGGGAGG + Intronic
1124863701 15:33468795-33468817 GATGTGATCCTGCCTTTGAGGGG + Intronic
1125363011 15:38884522-38884544 GAGGGGGTATTGCCTCTGGGAGG - Intergenic
1126876435 15:53046389-53046411 TAGGTGGTTCTGCCTGTGTAAGG - Intergenic
1127047726 15:55044439-55044461 GAGTTGGTAATGCCTGTGGGAGG - Intergenic
1128636752 15:69307517-69307539 GAGGTGTTCGTGCCTGGGGCTGG + Intronic
1129336310 15:74854202-74854224 GATGTGCCCCTGCCTGTGAGGGG + Intronic
1129600099 15:76993769-76993791 GAGGTGGTGGTGCCATTGGGAGG + Intronic
1131291696 15:91112105-91112127 GAGGTGGTATTGGCTGGGGGTGG + Intronic
1131510833 15:93048746-93048768 GAGGTGGGCTGGCCAGTGGGTGG - Intronic
1132224940 15:100133170-100133192 GATGTGGAGCTGCCTGTTGGGGG + Intronic
1132469974 16:97108-97130 GAGCAGGTGGTGCCTGTGGGTGG - Intronic
1132793697 16:1707587-1707609 GAGCTCGGCCTGCCTGTGTGTGG + Intronic
1132853853 16:2036203-2036225 GACCTGGGCCTGCCCGTGGGGGG + Intronic
1132861348 16:2073274-2073296 GAGGTGGCCATGCCGGTTGGTGG + Intronic
1134622036 16:15696770-15696792 CAGGTGGCCCAGCCTCTGGGCGG + Exonic
1135991916 16:27223564-27223586 GGGGTGGTCCTGCCTGCAGCGGG + Intergenic
1136367790 16:29816808-29816830 GAGGTGGAGCTGCCTGCGGATGG + Exonic
1138596957 16:58034324-58034346 GAGGTGCTGCTGCCTGCAGGTGG - Intronic
1139608704 16:68039328-68039350 GAGTGGCTCATGCCTGTGGGGGG + Intronic
1140473359 16:75226870-75226892 GAGGCGGCTCTGCCTGTGGCCGG - Intergenic
1140923174 16:79558146-79558168 GGGTTTTTCCTGCCTGTGGGGGG + Intergenic
1141119414 16:81340391-81340413 GAGGGGCACCTGCCTGTGTGAGG - Intronic
1142189790 16:88712551-88712573 AAGGTGGGGCTGTCTGTGGGGGG + Intronic
1142759724 17:2035429-2035451 GAGAGGGCCCTGCCTGTGGTGGG + Intronic
1142759743 17:2035472-2035494 GAGGGGGCCCTGCCTGTGGTGGG + Intronic
1142759758 17:2035501-2035523 GTGGGGGCCCTGCCTGTGGTGGG + Intronic
1144335980 17:14269295-14269317 GATGCAGCCCTGCCTGTGGGTGG - Intergenic
1144874611 17:18390906-18390928 GAGGTGGTAATGCTGGTGGGGGG - Intergenic
1145157615 17:20553515-20553537 GAGGTGGTAATGCTGGTGGGGGG + Intergenic
1145274863 17:21423256-21423278 GAGGTGTCACTTCCTGTGGGAGG - Intergenic
1145995555 17:29102994-29103016 CAGGGCTTCCTGCCTGTGGGAGG + Intronic
1145996713 17:29109056-29109078 GAAGGGGACCTGGCTGTGGGTGG + Intronic
1146207857 17:30920463-30920485 GAGGGGGTCTTGCCTGTGAGGGG - Intronic
1147976392 17:44250456-44250478 GAAGTGGCCATGCCTGTGTGAGG - Exonic
1148793937 17:50188334-50188356 GAGGCGGTCCTGTCTGGGAGAGG + Intronic
1149848543 17:60021568-60021590 GAGGTGGTAATGCTGGTGGGGGG + Intergenic
1149861626 17:60124956-60124978 GAGGTGGTAATGCTGGTGGGGGG - Intergenic
1151191882 17:72404717-72404739 GAGGTGGTCCAGCCTGAGCCAGG + Intergenic
1151997313 17:77618224-77618246 GAGGGGGTCCTACTCGTGGGAGG - Intergenic
1152474986 17:80512195-80512217 GAGCTCGTCCTGGCTCTGGGTGG + Intergenic
1152819588 17:82429992-82430014 GTGGTGGTGCTGACTGTGGCTGG - Intronic
1153543793 18:6185515-6185537 GTGGTGCTCCTGCTTGTGGTTGG + Intronic
1155513115 18:26597120-26597142 GAGGAGGACCTCCATGTGGGAGG + Intronic
1157414139 18:47488227-47488249 GTGGTTCTCCTGCCTGTAGGAGG - Intergenic
1157534613 18:48449091-48449113 GAGGTGCTCCTGCCTGCAGCGGG - Intergenic
1157561527 18:48649715-48649737 GAGGTGCACCTGCCTGTATGAGG - Intronic
1158920443 18:62186576-62186598 GAGGTGGTCCTGCCTGTGGGTGG - Intronic
1160864744 19:1251686-1251708 GAGGGGCTACTGCCTGTGTGCGG - Intronic
1160946428 19:1646043-1646065 GAGCTGGGCCTGTGTGTGGGTGG - Intronic
1161242076 19:3228298-3228320 GTGGGGGTCCTTCCTGGGGGAGG - Intronic
1161297361 19:3526675-3526697 GTGGGGGTCCTGCCCGTAGGGGG + Intronic
1161396673 19:4048232-4048254 CAGCTTGTCCTGCCTGTGGACGG + Exonic
1162086822 19:8254437-8254459 GAGATGGGACTGCCTGTGTGTGG - Intronic
1163302770 19:16458113-16458135 GGGGTGTTCCTGACAGTGGGGGG + Intronic
1163322997 19:16585528-16585550 GAGGTGGTGCTGACTGGGGCTGG - Intronic
1163543896 19:17929371-17929393 AAGGTGATTCTGCCTGTGGCTGG - Intergenic
1164905290 19:31962584-31962606 GAGGTGGTGCTGGTTGGGGGAGG - Intergenic
1165465986 19:35975112-35975134 CCAGTGGGCCTGCCTGTGGGGGG - Intergenic
1166627594 19:44373349-44373371 GTGGTGGTGCTGTGTGTGGGAGG - Intronic
1167148945 19:47698131-47698153 GAGTTGGGCCTGCCTGGTGGGGG + Intronic
1167747102 19:51358277-51358299 GATTCTGTCCTGCCTGTGGGAGG - Intronic
1168401984 19:56090432-56090454 TAGGGTGTGCTGCCTGTGGGTGG - Intronic
925084352 2:1096108-1096130 GAGTTACTCCTGCATGTGGGAGG - Intronic
925444980 2:3919860-3919882 GAGGTGGTTCTGCAGGTGAGAGG + Intergenic
925455648 2:4014461-4014483 TAGGAGGTGCAGCCTGTGGGAGG - Intergenic
926076193 2:9944990-9945012 GTGGTGGTACTGCCAATGGGTGG - Intergenic
928099878 2:28430737-28430759 GAGAGGGTCCTTCCTGTGGGAGG + Intergenic
928409352 2:31042572-31042594 GAGATGGACCAGGCTGTGGGTGG - Intronic
929779881 2:44950793-44950815 GAGGTTGGCATGCCTCTGGGTGG - Intergenic
931275932 2:60743951-60743973 GAGCTGGTCATACCTGTGTGTGG - Intergenic
931651403 2:64472062-64472084 GATGAGGTCCTGCCTGTAGAAGG + Intergenic
932622958 2:73276969-73276991 GTGCTGGTCCTTCCTGTGGGGGG + Intronic
933476965 2:82803476-82803498 GGGGTGGTGTTGGCTGTGGGCGG - Intergenic
934117997 2:88813874-88813896 GAGGTGGTCCAGCCACAGGGTGG - Intergenic
934975485 2:98799405-98799427 GGGGAGGTCCTGGCTGTGTGAGG - Intronic
934989998 2:98914291-98914313 GTGGTGCTCCTTGCTGTGGGGGG - Intronic
934997500 2:98978575-98978597 GAGGAGTACCTGGCTGTGGGAGG - Intergenic
936924376 2:117721670-117721692 GAGGTGATCCTGCCGTGGGGAGG + Intergenic
936938369 2:117859323-117859345 GAGGGGGTACTGCCTGCCGGGGG - Intergenic
937317900 2:120943668-120943690 GAGCTGTTCCTGCCTGTGTCTGG + Intronic
938248796 2:129798211-129798233 GAGCTGCTCCTGCCTTTGGAGGG - Intergenic
945198437 2:207258578-207258600 GAATTGGCCCTGCCTGGGGGAGG + Intergenic
947722505 2:232378478-232378500 GAGGGGCTCCTGGCTGCGGGAGG + Intergenic
1168800653 20:642053-642075 GGGGTGGAGTTGCCTGTGGGGGG + Intergenic
1168800789 20:642337-642359 GGGGTGGAGTTGCCTGTGGGGGG + Intergenic
1171427966 20:25060211-25060233 GAGTTGGTCCTGGCTGTGGATGG - Intergenic
1172305257 20:33876090-33876112 GAGGGGATCCTGACAGTGGGAGG + Intergenic
1172808360 20:37629512-37629534 CAGGTGTGCCTGCCAGTGGGAGG + Intergenic
1173730197 20:45322994-45323016 CAGGTGCTCCTGCCCCTGGGTGG + Intergenic
1175327774 20:58141747-58141769 CAGGTGGCCAGGCCTGTGGGTGG - Intergenic
1176611844 21:8990987-8991009 TAGGTGATCCTGGATGTGGGAGG - Intergenic
1181293685 22:21817993-21818015 GAGGTGGGCCTGGGTCTGGGAGG + Intronic
1182194941 22:28506334-28506356 AGGGAGGTCCTGCCTGTGAGGGG - Intronic
1182366213 22:29781160-29781182 GAGGTGGCCCTCCCTGTTTGGGG - Intergenic
1182615490 22:31586235-31586257 GAGGTGGACTGGCCTGGGGGAGG - Intronic
1183100829 22:35583126-35583148 CAGGGGCTCCTGCCAGTGGGAGG + Intergenic
1183365185 22:37403189-37403211 CAGGTGCACCTGCCTGGGGGTGG - Intronic
1183517664 22:38276484-38276506 TAGTTGGTGCTCCCTGTGGGAGG + Intergenic
1184978575 22:48080454-48080476 GAGGTGGCCCTGCCTGGGCCTGG - Intergenic
1185067155 22:48638337-48638359 GGGGTGGTATTGCCTGTGTGTGG - Intronic
1185067255 22:48638663-48638685 GGGGTGGTATTGCCTGTGTGTGG - Intronic
1185067282 22:48638748-48638770 GGGGGGGTCCCGCCTGTGTGTGG - Intronic
1185067325 22:48638876-48638898 GGGGGGGTCCCGCCTGTGTGCGG - Intronic
1185075654 22:48680701-48680723 GATGTGGTCCTCACCGTGGGAGG + Intronic
1185137163 22:49079625-49079647 GAGGTGGGCCAGGCTGTGGTGGG + Intergenic
1185223852 22:49642214-49642236 CAGGTGGCCCTGTGTGTGGGGGG + Intronic
950309948 3:11948548-11948570 AAGATGCTCCTGCTTGTGGGTGG - Intergenic
951833723 3:26959075-26959097 GAGGTGCACCTGCCTGTATGAGG + Intergenic
952906004 3:38139455-38139477 AAGGTGTGCCTGTCTGTGGGCGG - Intronic
953208919 3:40857338-40857360 GAAGTGATCCTACCTGTGTGTGG - Intergenic
954368813 3:50159678-50159700 GAGGTGGTCCTGGGTGGGGAAGG - Exonic
954806375 3:53223310-53223332 CAGGTGGCCCTGCCTGTGAACGG + Intergenic
955357255 3:58241349-58241371 GGGGTGTTGCTGCCTGTGGCTGG + Intronic
957506329 3:81125664-81125686 GAGGCTGCTCTGCCTGTGGGAGG - Intergenic
960701033 3:120439629-120439651 AATGTGCTCCTTCCTGTGGGTGG + Intronic
961869169 3:129975683-129975705 GCAGTGGTCCTGCTTCTGGGAGG + Intronic
962068896 3:132012534-132012556 TAGGTGGTACTGGGTGTGGGTGG + Intronic
963780363 3:149480474-149480496 CATCTGGCCCTGCCTGTGGGTGG - Intronic
964137205 3:153357698-153357720 GAAGTGCTCCTGACTGTAGGAGG - Intergenic
964386572 3:156154161-156154183 GAGGTGGTGCTTTCTGAGGGAGG + Intronic
964564528 3:158034898-158034920 GAGGGGTACCTGCCTGTGTGAGG - Intergenic
965673848 3:171174239-171174261 GAGGTGAGCCTGTGTGTGGGTGG + Intronic
966910305 3:184555964-184555986 AAGGTGGTTCTGACTCTGGGGGG - Intronic
967148511 3:186626900-186626922 GAGGGGATCCTGCCTGAGGATGG - Intergenic
967831277 3:193922148-193922170 GGGGTGGTTCTGCCTCTGTGGGG + Intergenic
967950614 3:194837590-194837612 GAGCTGGTCCCGCGTGTAGGTGG + Intergenic
968433405 4:572753-572775 CAGGTGGACCTGCCCGGGGGTGG - Intergenic
968636144 4:1681053-1681075 CAGGAGGTCCTGCATGTGTGAGG + Intronic
968870921 4:3241827-3241849 GAGGTGGTCCTGGCTGGGGGAGG - Exonic
969305616 4:6324742-6324764 AAGGGGTTCCTGCCGGTGGGAGG + Intronic
969588504 4:8108254-8108276 GCGGTGGTCCTTGCTGTTGGTGG - Intronic
969641509 4:8401768-8401790 GAGGTGGTCCTGCCTGCCTGTGG + Intronic
969673616 4:8602966-8602988 GTGGTGGAGCTGCCTGTGGGAGG + Intronic
970713124 4:18887674-18887696 GAGGTGGTGGGGCCTTTGGGAGG + Intergenic
981468880 4:145106615-145106637 GAGGTGGTCCTCTTTGAGGGTGG + Intronic
986656311 5:10016403-10016425 GAGGGGCACCTGCCTGTGTGAGG + Intergenic
987926893 5:24353259-24353281 GTGGGGCTCCTGCCTGTGGTGGG - Intergenic
990825542 5:59893789-59893811 GAGGGGGCCCTGCCAGCGGGAGG + Exonic
991964139 5:72074241-72074263 TATGTGGTCCTGCCTTCGGGGGG - Intergenic
992080667 5:73232756-73232778 GAGGTGGTTCTGCCTGCCGCTGG + Intergenic
992780981 5:80127201-80127223 GAGGTGTCCCTTCTTGTGGGAGG + Intronic
996272057 5:121617375-121617397 GAGTTGTTCGTGCCTGCGGGCGG - Intergenic
997385350 5:133468040-133468062 GAGAGGCTCCTGCCTGTGAGAGG - Intronic
997612528 5:135225062-135225084 GAGGTGCTGGAGCCTGTGGGAGG + Intronic
998205185 5:140152667-140152689 GGGGTGGCCCCACCTGTGGGAGG + Intergenic
998258555 5:140609524-140609546 GGTGTGGTCCTGCCCGGGGGTGG - Intergenic
998772591 5:145563270-145563292 CAGGAGGTCCCGTCTGTGGGTGG - Intronic
998947366 5:147354035-147354057 GAGGTGGCTCTGCATGTAGGGGG - Intronic
999847525 5:155500991-155501013 AAGGTGGTACTGGCTGTTGGTGG - Intergenic
1001041790 5:168341475-168341497 GATGTGTTCCTGCCTGGGGCTGG - Intronic
1001081588 5:168671471-168671493 GAGGTGGGGATGCCTGTGGGAGG + Exonic
1002321932 5:178381460-178381482 GAGAGGGTCCTGCCTGTCGCTGG + Intronic
1002560692 5:180080018-180080040 GACCTGGTCCTGCCTTTGGGAGG + Intergenic
1002686964 5:181020385-181020407 GAGGTGTTCTTGTCTGTGGATGG - Intergenic
1003831926 6:10021323-10021345 GAGGTGCACCTGCCTGTATGAGG + Intronic
1005936041 6:30521561-30521583 GAGGGGCACCTGCCTGTGTGAGG - Intergenic
1006445825 6:34079288-34079310 GAGGTGGTCCTATCTCAGGGTGG - Intronic
1010820614 6:80411345-80411367 GAGGGGGACCTGCCTGTATGAGG + Intergenic
1011189654 6:84716002-84716024 GAGGGGGTACTGCCTTTGGTAGG + Intronic
1012263983 6:97119149-97119171 TAGGTGGCTCTACCTGTGGGAGG + Intronic
1014924622 6:127255798-127255820 GAGGGGCACCTGCCTGTGTGAGG - Intergenic
1015185614 6:130412425-130412447 GAGATGGGACTCCCTGTGGGAGG - Intronic
1019332571 7:467662-467684 GAGGTGGTAATGCTTGTGGGAGG - Intergenic
1019545934 7:1576158-1576180 CCGGTGGTCCTGCCTGTGGAAGG + Intergenic
1022607063 7:31825769-31825791 GAGGTGGTACTGCCTCTGTATGG + Intronic
1023168212 7:37363947-37363969 TGGGTGGTGTTGCCTGTGGGGGG - Intronic
1024548237 7:50539869-50539891 GAAGGGGTCCTGGCTGTGGTGGG - Intronic
1026020280 7:66700330-66700352 GAAGGGGTCCTGCCTGTGTAGGG + Intronic
1027353952 7:77338721-77338743 TAGGTGGTGGTGCCTTTGGGAGG - Intronic
1028588452 7:92473396-92473418 GAGGGGGTACTGCCTTTGGTAGG + Intronic
1029470395 7:100750910-100750932 GCGGGGGTCCTGTCTGTGTGAGG + Intronic
1030843363 7:114381844-114381866 GAGGGGGTACTGCCTTTGGTAGG + Intronic
1032012252 7:128354227-128354249 GAGCTGACCCTGCCTGTGGCTGG - Intronic
1032476363 7:132214109-132214131 GAGGTGGTCCTGCCCACTGGTGG - Intronic
1033858846 7:145599661-145599683 GAAGTGGTCGTGCCTGGTGGGGG - Intergenic
1034313489 7:150110430-150110452 CAGGTGGGGCTGCCTGAGGGTGG + Intergenic
1034313508 7:150110499-150110521 GAGGTGGGGCTGCCTGAGGGTGG + Intergenic
1034313526 7:150110568-150110590 CAGGTGGGGCTGCCTGAGGGTGG + Intergenic
1034793371 7:153990234-153990256 CAGGTGGGGCTGCCTGAGGGTGG - Intronic
1036638517 8:10567586-10567608 GAGAGGGTCCTGGCTTTGGGGGG - Intergenic
1036822185 8:11950087-11950109 GAGGTGGCTCAGCCTGTGGGTGG + Intergenic
1037569663 8:20147755-20147777 GGGGTGGTACTAACTGTGGGTGG - Intronic
1038929028 8:32172115-32172137 GAGGAGTACCTGGCTGTGGGAGG - Intronic
1040527616 8:48238680-48238702 GAGGGGGTACTGCCTTTGGTAGG + Intergenic
1040544896 8:48391337-48391359 GCTCTGGTCCTTCCTGTGGGAGG - Intergenic
1040839654 8:51771805-51771827 CAGGCGGTGCTGCCTGTGGGTGG + Intronic
1040879736 8:52191995-52192017 CAGGTTGTTCTGTCTGTGGGTGG - Intronic
1043728478 8:83644282-83644304 GAGGTAGTGCTGCCTTTGGGAGG + Intergenic
1048075636 8:131067218-131067240 CAGCTGGTCCTGCCTGTGTTAGG + Intergenic
1048331321 8:133472506-133472528 GAAATGGTCCTGCCTGCAGGGGG + Intronic
1049069405 8:140345206-140345228 GAGGAGGTCCTCTGTGTGGGTGG + Intronic
1049758983 8:144323389-144323411 GTGGGGGTGCTGCCTCTGGGTGG - Intronic
1051629397 9:19127817-19127839 GTCGGGGTCCTGCCTGTGGTCGG + Intronic
1052608979 9:30744295-30744317 GTGGTGGTCCTGCTGCTGGGAGG + Intergenic
1057722477 9:97544142-97544164 GGTGTGATCCTGCCTCTGGGAGG - Intronic
1057791254 9:98126656-98126678 GAGGTCTTCCTCCCTGTTGGAGG - Exonic
1058572197 9:106358836-106358858 AAGGTGGTCTTGCCCGTGGGAGG - Intergenic
1060279643 9:122207128-122207150 GAGCTGTCCCTTCCTGTGGGAGG - Intronic
1060411383 9:123402760-123402782 GAAGTGGACCTGCCTGTGGTGGG - Intronic
1060886845 9:127160556-127160578 GAGGAGGTCCAGTCTGCGGGTGG + Intronic
1061377875 9:130236761-130236783 GAGGTGGGCCTCCCTGGGGCCGG - Exonic
1061594057 9:131617415-131617437 AAGATGGTCCTGCCTGTCTGAGG - Intronic
1062456306 9:136640842-136640864 GAGGCAGTCCAGGCTGTGGGTGG - Intergenic
1062684431 9:137803001-137803023 GAGGTGGCCCCACCTGGGGGTGG - Intronic
1187875118 X:23797468-23797490 TAGGTGGTGCTGCGTGTGTGTGG + Intergenic
1188980893 X:36726147-36726169 GTTGTGGTCCTGCCTATAGGTGG - Intergenic
1190554907 X:51623886-51623908 GAGGGGTTCCTGGCTGTGTGAGG - Intergenic
1192225883 X:69227582-69227604 GAGGTGGGGCAGCCTGGGGGAGG - Intergenic
1192235276 X:69291636-69291658 GAGGTGATACTGGCTTTGGGTGG + Intergenic
1192432155 X:71119619-71119641 CAGGTGGTCCTGCCTTTTGCTGG - Intronic
1195808432 X:108801561-108801583 GAGGGGCTCCTGCCTGTATGAGG - Intergenic
1198118377 X:133566729-133566751 GATGAGGTCCTGTCTGTAGGAGG - Intronic
1200057816 X:153470739-153470761 ACTGTGGTCCTGCCTCTGGGTGG - Intronic
1200142729 X:153909935-153909957 GAGGGGGTCCAAGCTGTGGGAGG + Intronic
1200235503 X:154466013-154466035 GAGGTGGGCCTGCGGGTGGCTGG + Exonic
1202196944 Y:22306716-22306738 GTGGTGGTCCTGGCGGCGGGTGG + Intergenic