ID: 1158921077

View in Genome Browser
Species Human (GRCh38)
Location 18:62191433-62191455
Sequence ACATGTACCCTGGAAGTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 6, 3: 48, 4: 254}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158921077_1158921081 -5 Left 1158921077 18:62191433-62191455 CCTTCAACTTCCAGGGTACATGT 0: 1
1: 0
2: 6
3: 48
4: 254
Right 1158921081 18:62191451-62191473 CATGTGCAGGGTGTGCAGATTGG 0: 1
1: 0
2: 12
3: 67
4: 325
1158921077_1158921082 4 Left 1158921077 18:62191433-62191455 CCTTCAACTTCCAGGGTACATGT 0: 1
1: 0
2: 6
3: 48
4: 254
Right 1158921082 18:62191460-62191482 GGTGTGCAGATTGGTGACATAGG 0: 1
1: 0
2: 7
3: 238
4: 2381
1158921077_1158921083 20 Left 1158921077 18:62191433-62191455 CCTTCAACTTCCAGGGTACATGT 0: 1
1: 0
2: 6
3: 48
4: 254
Right 1158921083 18:62191476-62191498 ACATAGGTAGACATGTGTCATGG 0: 3
1: 297
2: 4386
3: 7547
4: 7003
1158921077_1158921084 23 Left 1158921077 18:62191433-62191455 CCTTCAACTTCCAGGGTACATGT 0: 1
1: 0
2: 6
3: 48
4: 254
Right 1158921084 18:62191479-62191501 TAGGTAGACATGTGTCATGGTGG 0: 2
1: 256
2: 4504
3: 9302
4: 29015

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158921077 Original CRISPR ACATGTACCCTGGAAGTTGA AGG (reversed) Intronic
901118044 1:6864737-6864759 CCATGGACCCTGCAAGTGGATGG - Intronic
904207907 1:28866623-28866645 ACATGGACCCTGGAATTCCAGGG - Intergenic
905963415 1:42065333-42065355 ACAAGTACCCTAGAACCTGAAGG + Intergenic
906626836 1:47332552-47332574 ACATGAAGCCTGGTAGTGGAGGG - Intergenic
906878223 1:49561329-49561351 ACATGTACCCTAAAACTTTAGGG - Intronic
908553429 1:65232943-65232965 ACATGAACCCAGGAGGTTGAGGG - Intergenic
912140059 1:106713768-106713790 ACTTGAACCCAGGAAGTGGAGGG - Intergenic
912763621 1:112389656-112389678 ACATGTTCCCCTGAAGCTGATGG - Intergenic
917729007 1:177855479-177855501 ACATGTACCCTAGAACTTAAAGG + Intergenic
917825418 1:178815161-178815183 ACATGAACCCAGGAGGTGGAGGG - Intronic
917893191 1:179460061-179460083 ACATGTACCCTAGAACTTAAAGG - Intronic
918222150 1:182444772-182444794 TCTCGTACCCTTGAAGTTGAGGG + Intergenic
919219348 1:194606558-194606580 ACATGTACCCTAGAACTTAAAGG - Intergenic
920138183 1:203787673-203787695 ACTTGAACCCAGGAATTTGAGGG - Intergenic
920456262 1:206103936-206103958 ACTTGAACCCAGGAATTTGAAGG - Intergenic
921021801 1:211242673-211242695 ACATGTACCCTAGAACTTAAAGG + Intergenic
921714820 1:218407178-218407200 GCTTGAGCCCTGGAAGTTGAGGG - Intronic
921987194 1:221325182-221325204 AGATATAGCCTTGAAGTTGAGGG - Intergenic
922717564 1:227885266-227885288 CCCTGTGCCCTGGAAGTTCAGGG + Intergenic
924848943 1:247804467-247804489 ACATGTATCCTAGAACTTAAAGG - Intergenic
1063065540 10:2604896-2604918 ACATTTACCCTGGAGTTTGCAGG - Intergenic
1063384833 10:5609622-5609644 ACATGTGGCCTGGAAGGTGTTGG + Intergenic
1063813503 10:9743102-9743124 ACATGTACCCTAGAACTTAAAGG - Intergenic
1065603921 10:27396111-27396133 ACTTTTACCCTGGAACTTGTTGG - Intergenic
1066019912 10:31288010-31288032 ACATGTACCCTAAAACTTAAAGG + Intergenic
1066209685 10:33224569-33224591 ACAGGTACCCTGAAACTTAAAGG - Intronic
1067740071 10:48888781-48888803 ACATAGACCCTGAAACTTGAAGG - Intronic
1068302174 10:55157927-55157949 ACATGTACCCTAGAACTTAAAGG + Intronic
1068553157 10:58428313-58428335 ACATGTACCCTAGAATTTAAAGG - Intergenic
1069349556 10:67509210-67509232 ACATGTACCCTAGAACTTAAAGG - Intronic
1070122727 10:73594485-73594507 GCATGAACCCAGGAATTTGAGGG - Intronic
1070607531 10:77909477-77909499 ACATGTACCCCAGAACTTAAAGG + Intronic
1072817308 10:98522106-98522128 ACATGTACCCTAGAACTTAAAGG + Intronic
1074647830 10:115483454-115483476 AAATGTATGCTGAAAGTTGAAGG - Intronic
1075531597 10:123234759-123234781 ACATGTAACCTGACATTTGAAGG - Intergenic
1078378580 11:10818468-10818490 ACTTGTAACCTGGGAGTAGAAGG + Intronic
1078862955 11:15269885-15269907 ACATGTACCCTAAAACTTAAAGG - Intergenic
1079003872 11:16779161-16779183 CCATGTGTCCTGGAAGCTGAGGG - Intronic
1079213361 11:18483785-18483807 ATATGTTCCCTGGATGTTGTGGG - Intronic
1080372695 11:31670261-31670283 AAATGTACCCTTCAAATTGAGGG + Intronic
1080810298 11:35697471-35697493 ACATGTACCCTAAAACTTAAAGG - Intronic
1081240756 11:40703494-40703516 ACTTGAGCCCTGGAGGTTGATGG + Intronic
1081463368 11:43292396-43292418 ACATATAGACTGGAAGTAGAGGG + Intergenic
1081906466 11:46673515-46673537 ACAAGTACCCAGGCAGTTGGGGG - Intronic
1082052311 11:47781343-47781365 ACATGAGCCCTGGAGGTTGAGGG - Intronic
1082691752 11:56313400-56313422 ACATGTACCCTAAAACTTAAAGG - Intergenic
1083756961 11:64796980-64797002 ACATGCACCTTGGGAGTTGGGGG + Exonic
1083967921 11:66054097-66054119 ACTTGAACCCTGGAGGTGGACGG + Intronic
1086871687 11:92045026-92045048 ACATGTACCCCAGAACTTAAAGG + Intergenic
1088411978 11:109544280-109544302 ACATGTACCCTAGAACTTAAAGG + Intergenic
1089854110 11:121525943-121525965 ACATGAGCCCTGGTGGTTGAAGG + Intronic
1090686299 11:129125183-129125205 AAATTTCCCCTGGAAGTTGTTGG + Intronic
1090873485 11:130768542-130768564 ACATGTACCGTGGTATCTGATGG - Intergenic
1091196727 11:133737952-133737974 ACATGTACCCTAGAACTTAAAGG + Intergenic
1096317448 12:50580680-50580702 AAATGTACCCTGACGGTTGAGGG - Intronic
1096560392 12:52431846-52431868 ACATGTTCCCTCTACGTTGATGG - Intronic
1096726128 12:53564291-53564313 ACCTGAACCCAGGAAGTGGAGGG + Intronic
1097160218 12:57040968-57040990 ACATGTACCCTGGGAGGCCAGGG + Intronic
1098434444 12:70453671-70453693 ACAATTAGCCTGGAATTTGAAGG - Intergenic
1098688324 12:73454122-73454144 ATATGTATCCTGAAAGTTGTAGG - Intergenic
1100916121 12:99423967-99423989 ACATGTACCTCTGAACTTGAGGG + Intronic
1102442489 12:112974503-112974525 ACTTGAACCCAGGAAGTGGAGGG - Intergenic
1103604427 12:122076696-122076718 ACCTGAGCCCTGGAGGTTGAGGG + Intergenic
1105073309 12:133251051-133251073 ACATGTACCCTAAAACTTAAAGG + Intergenic
1105640027 13:22252675-22252697 ACTTGTACCCTGGCAGTCGCTGG - Intergenic
1107846449 13:44518791-44518813 ACTTGAACACTGGGAGTTGATGG - Intronic
1107911333 13:45108336-45108358 ACTTGAGCCCAGGAAGTTGAAGG - Intergenic
1108908212 13:55506077-55506099 ACATGTACCCCTGAAGTTGAAGG + Intergenic
1109701790 13:66035374-66035396 ACATGTACCCTAAAACTTAAAGG + Intergenic
1109776185 13:67043903-67043925 GCATATACCCTGGAGGTTTAGGG - Intronic
1110137704 13:72088814-72088836 ACACGTATCCTGTAAGGTGATGG - Intergenic
1110659850 13:78047654-78047676 ACATGTACCCTAGAACTTAAAGG - Intergenic
1110670904 13:78176356-78176378 ACATGTACCCCTGAACTTAAAGG - Intergenic
1112043645 13:95573744-95573766 ACATGTACCCTAGAACTTAGAGG - Intronic
1113366786 13:109683970-109683992 AAAAGTAACCTGAAAGTTGAGGG + Intergenic
1114040403 14:18673065-18673087 ACTTGAACCCTGGAGGTGGAGGG + Intergenic
1114045440 14:18871581-18871603 ACTTGAACCCTGGAGGTGGAGGG + Intergenic
1114118772 14:19647887-19647909 ACTTGAACCCTGGAGGTGGAGGG - Intergenic
1114629916 14:24152251-24152273 ACAAATACACTGGAAGTGGAGGG - Intronic
1118039193 14:61899274-61899296 CCATGTACCCTGAAACTTGAGGG + Intergenic
1118457198 14:65955684-65955706 ACAGGTAAAATGGAAGTTGATGG - Intergenic
1118937894 14:70304777-70304799 ACATGTACCCTAGAACTTAAAGG - Intergenic
1120677656 14:87440228-87440250 ACACGAACCCTGGAATTTGGAGG - Intergenic
1122027576 14:98888700-98888722 ACAAGTACCTTGGAGGGTGAGGG + Intergenic
1123903674 15:24901011-24901033 ACTTGAGCCCTGGAGGTTGAGGG + Intronic
1127964594 15:63914261-63914283 GCATGCAACCTGGAAGTGGATGG + Intronic
1128235703 15:66065856-66065878 CCAAGTTCCCTGGAAGGTGAGGG - Intronic
1130544037 15:84841625-84841647 ACCTGTTCCCTAGAAGATGATGG - Intronic
1130544707 15:84846601-84846623 ACTTGAACCCAGGATGTTGAGGG + Intronic
1130735616 15:86545412-86545434 ACTTGTACCCCTGAACTTGAAGG - Intronic
1131745556 15:95443421-95443443 AAATGTACCTGGGAAGATGATGG + Intergenic
1133634582 16:7653421-7653443 ACTTGAGCCCTGGAAGTCGAGGG + Intronic
1134431648 16:14214241-14214263 AAATGTAACTTGGGAGTTGATGG - Intronic
1136697000 16:32090422-32090444 ACATGCATCCTGGAATTTTAAGG - Intergenic
1136797500 16:33033712-33033734 ACATGCATCCTGGAATTTTAAGG - Intergenic
1140019950 16:71229278-71229300 ACATATACCCTAGAACTTAAAGG + Intronic
1142906425 17:3045563-3045585 ACATGTACCCCAGAACTTAAAGG - Intergenic
1143276057 17:5711716-5711738 TCATGTACTGTCGAAGTTGATGG + Intergenic
1143292632 17:5843270-5843292 ACTTGAACCCAGGAAGTAGAGGG - Intronic
1145293660 17:21571372-21571394 ACATGTATCCTGGAACTTAAAGG + Intronic
1145386321 17:22414567-22414589 ACATGTATTCTGGAACTTAAAGG - Intergenic
1146800788 17:35819040-35819062 ACATTTATCCTATAAGTTGAAGG - Intronic
1147124422 17:38356296-38356318 ACTTGTGCCCAGGAAGTTCAAGG + Intronic
1147498159 17:40937345-40937367 AAAGGCACCCTGGAAGTGGAAGG - Exonic
1148433018 17:47657997-47658019 ACTTGAACCCAGGAATTTGAGGG + Intronic
1149139495 17:53413157-53413179 ACATGTACCCTAGAACTTAAAGG + Intergenic
1150185996 17:63181878-63181900 GCAAGTACACTGGAAGCTGAAGG - Intronic
1151918358 17:77135617-77135639 ACTTGAACCCAGGAGGTTGAGGG - Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1156923080 18:42546727-42546749 ACATGTACCCTAGAACTTAAAGG - Intergenic
1157735506 18:50045164-50045186 ACATGTACCCTGGAATATTTAGG + Intronic
1158086447 18:53657031-53657053 ACATGTACCCTAGAACTTAAAGG + Intergenic
1158921077 18:62191433-62191455 ACATGTACCCTGGAAGTTGAAGG - Intronic
1159758830 18:72399187-72399209 ACATGTACCCTAGAACTTAAAGG + Intergenic
1161187854 19:2934435-2934457 ACATGTCCCCTGAAAGATGAGGG + Exonic
1161222546 19:3124305-3124327 ACAGGTGCCCTGGAAGGTGAGGG - Intergenic
1161857653 19:6774835-6774857 ACTTGAACCCAGGAAGTGGAGGG - Intronic
1163492860 19:17627081-17627103 ACTTGAACCCAGGAAGTGGAGGG + Intronic
1164762107 19:30736028-30736050 ACATGCACCCTGGGGGTTCAAGG - Intergenic
1164841012 19:31392114-31392136 ACATTTAGCCGGGACGTTGATGG - Intergenic
1166052721 19:40270015-40270037 CCATGTATCCTGGCAGCTGAGGG - Intronic
1166137834 19:40787877-40787899 ACTTGAACCCAGGAAGCTGAGGG + Intronic
1167043084 19:47034229-47034251 ACTTGAACCCAGGAAGTGGAGGG + Intronic
927236162 2:20876847-20876869 ACCTGTACTCTGGAGGATGACGG + Intergenic
928517268 2:32055278-32055300 ACTTGAGCCCTGGAGGTTGAGGG + Intergenic
928820818 2:35358524-35358546 ACGTGTACCCTAGAACTTAAAGG - Intergenic
930080709 2:47446120-47446142 ACTTGAACCCAGGAATTTGAGGG - Intronic
931084232 2:58811223-58811245 ATATGTACCTTTGCAGTTGAAGG + Intergenic
935038844 2:99405902-99405924 AAATGTACCTGGGAAGGTGACGG + Exonic
935217745 2:100988195-100988217 AGATCTGCCCTGGAAGTTGGGGG - Exonic
938021600 2:127910246-127910268 ACTTGAGCCCAGGAAGTTGAGGG - Intergenic
941948018 2:171121720-171121742 AAATTTACCATGGAAGATGAGGG + Intronic
944243020 2:197504043-197504065 ACAAGTACCATGTAAATTGAGGG + Intronic
944321933 2:198356146-198356168 ACATGGAGCCTGGAGGTTGGAGG + Intronic
945350023 2:208766253-208766275 ACATGTACCCTAGAACTTAAAGG + Intronic
947055782 2:226101317-226101339 ACATATAGCCTGGAAGAAGAGGG - Intergenic
947283781 2:228486865-228486887 ACATGTACCCTAAAACTTAAAGG - Intergenic
947436996 2:230081311-230081333 AAATGTCCTCTGGAAATTGAGGG - Intergenic
947939746 2:234041000-234041022 ACATGTAGGCTGAAAGTTAAAGG + Intergenic
1169233878 20:3912865-3912887 ACTTGAACCCTGGAGGTGGAGGG + Intronic
1170717703 20:18846429-18846451 ACATGTACCCTAAAACTTAAAGG - Intergenic
1170761431 20:19254676-19254698 ACATGTTCCCTGGAGCTAGAAGG + Intronic
1171058588 20:21933068-21933090 ACATGTACCCTAAAACTTAAAGG + Intergenic
1171137192 20:22706693-22706715 ACATGTAGCCTGAAAGTAAAGGG - Intergenic
1171207604 20:23293364-23293386 ACATGCACCCTGGTAGGTCAAGG - Intergenic
1171219129 20:23378239-23378261 ACCTGAACCCAGGAGGTTGAGGG + Intronic
1172409467 20:34710684-34710706 ACATGTAAGGTGGGAGTTGAAGG - Exonic
1173429244 20:42971487-42971509 ACATGAGGCCTGGAAGGTGATGG - Intronic
1173625309 20:44468000-44468022 ACATCAACCCTGGAAGGTGAAGG - Intergenic
1174091603 20:48053169-48053191 ACCTGAGCCCTGGAGGTTGAGGG - Intergenic
1174701532 20:52614285-52614307 ACATGCAGCCAGAAAGTTGAGGG + Intergenic
1176702643 21:10074878-10074900 ACATGTACCCCTGAAATTAAAGG - Intergenic
1176997637 21:15575769-15575791 ACTTGAACCCAGGAAGTGGAGGG - Intergenic
1177543551 21:22527890-22527912 ACATGTACCCTAGAACTTAAAGG - Intergenic
1177856007 21:26400869-26400891 ACATGTACCCTGGAACTTAAAGG - Intergenic
1178767807 21:35470942-35470964 ACATGTACCCTAGAACTTAAAGG - Intronic
1179189230 21:39108801-39108823 GCCTGTACCCAGGAAGTAGAGGG - Intergenic
1180403184 22:12513417-12513439 ACATGTACCCTAAAACTTAAAGG + Intergenic
1180463971 22:15594198-15594220 ACTTGAACCCTGGAGGTGGAGGG + Intergenic
1181543456 22:23587193-23587215 ACATGTACCCTGGAAGCATGGGG - Intergenic
1182304361 22:29357768-29357790 ACTTGTACCCAGGAAGTCGGAGG - Intronic
1182901869 22:33905146-33905168 CCTTGTGCCCAGGAAGTTGAGGG - Intronic
1183106834 22:35620940-35620962 ACCTGTAGCTTTGAAGTTGATGG + Intronic
1184230765 22:43157251-43157273 ACGTGTACCCTGGAAGCTGGAGG + Intronic
949668078 3:6364696-6364718 ACTTGTATCCTGGAACTTAAAGG + Intergenic
949833404 3:8241573-8241595 ACATGTACCTTAGAACTTAAAGG + Intergenic
950046411 3:9951079-9951101 ACAAGTGCCCAGGAAGATGAGGG - Intronic
950199239 3:11031086-11031108 ACATGGACTCTGGAGGCTGATGG - Intronic
950507048 3:13401441-13401463 AGATGGACCTTGGAAGTTCACGG + Intronic
952048684 3:29357067-29357089 ACATGTACCCTAGAACTTAAAGG - Intronic
953750142 3:45602419-45602441 TCCTGTACCCAGGAAGTGGATGG + Intronic
954474759 3:50733586-50733608 ACACATAGCCTGGAAGTGGAGGG - Intronic
954815894 3:53280254-53280276 ACATGTCCCCTGGCAGATAAGGG - Intergenic
955564331 3:60227480-60227502 ACATTTCCCTTGGAATTTGAGGG + Intronic
955939491 3:64134141-64134163 ACATTTACTCAGGAAGCTGAGGG + Intronic
956585890 3:70864306-70864328 AAATGAGCCCTGGAATTTGAGGG + Intergenic
958907596 3:99959230-99959252 ACTTGTAACCTGGGAGTTGGAGG - Intronic
961427649 3:126860568-126860590 ACATATACCCTAGAACTTAAAGG + Intronic
962475897 3:135754929-135754951 TCATGCATCCTGGAATTTGAGGG + Intergenic
962534005 3:136310437-136310459 ACTTGAGCCCAGGAAGTTGAGGG + Intronic
962794183 3:138836341-138836363 ATATGAACCCAGGAAGTCGAGGG + Intergenic
963307852 3:143673890-143673912 AGATTTACCGTGGAAGTGGATGG + Intronic
963959547 3:151293808-151293830 ATATCTATCCTTGAAGTTGAAGG - Intronic
964033642 3:152168823-152168845 ACATGTACCCTAAAACTTAAAGG + Intergenic
964329644 3:155588284-155588306 ATATGACCCCTGGAAGTTAAGGG + Intronic
964545230 3:157827060-157827082 CAATGTACTCTGGAAGTTCAGGG - Intergenic
964576253 3:158171866-158171888 ACATGAATCCTGGAAGGTCAAGG + Intronic
965214809 3:165849346-165849368 GCACGTACCCTGGAAATTAAAGG - Intergenic
965965593 3:174485308-174485330 ACATGTACCCCTAAACTTGAAGG - Intronic
966031981 3:175360887-175360909 ACATGTACCCTAGAACTTAAAGG - Intronic
966766749 3:183470061-183470083 ACTTGAACCCAGGAAGTGGAGGG - Intergenic
968705782 4:2076763-2076785 ACCTGTACCCTGGGGCTTGAAGG - Intronic
971181347 4:24330995-24331017 AAATGTACCCAGGAATTTGGAGG - Intergenic
971334469 4:25710207-25710229 ACCTGAGCCCTGAAAGTTGAGGG - Intergenic
973167432 4:47094739-47094761 ACATGTACCCATGAACTTAAAGG + Intronic
973786585 4:54338015-54338037 ACATGGACTCTGGCACTTGATGG + Intergenic
973835371 4:54804070-54804092 TTATGAACCCTGGAAATTGAAGG + Intergenic
974112972 4:57546806-57546828 ACATGTACCCTAAAACTTAAAGG + Intergenic
974114069 4:57559302-57559324 ACATGTACCCCAGAACTTAAAGG - Intergenic
975010370 4:69343141-69343163 ACATGTGCCCTAGAACTTAAAGG + Intronic
975312625 4:72919356-72919378 ACTTGAACCCGGGAAGTGGAGGG + Intergenic
976008324 4:80457444-80457466 ACATGGGCCATGGAAGCTGAGGG - Intronic
976079343 4:81337635-81337657 ACATGTACCCTGGAACTTAAAGG - Intergenic
976769982 4:88640708-88640730 ACATGTGTCCTGGAACTTAAAGG + Intronic
977691322 4:99914616-99914638 ACATGTACCCTAGAACTTAAAGG + Intronic
978160613 4:105542990-105543012 ACATGGACACTGGAACTGGAAGG - Intergenic
978808508 4:112825310-112825332 ACATGTACCCTAGAACATAAAGG + Intronic
979044412 4:115843960-115843982 CCATGTACTCTTGAAATTGAGGG + Intergenic
979603052 4:122607350-122607372 ACATGTATCCTGGAACTTAAAGG - Intergenic
980215949 4:129853317-129853339 ACATGTCCCTTGTCAGTTGAAGG - Intergenic
981208513 4:142072450-142072472 ACATGTACCCCAGAACTTAAAGG + Intronic
982389709 4:154851108-154851130 ACAGGACCCCTGGAATTTGAAGG + Intergenic
982700403 4:158654849-158654871 ACCTGAACCCTGGAGGTGGAGGG - Intergenic
983440466 4:167777224-167777246 ACATGTACCCTAGAATTTAAAGG - Intergenic
984690774 4:182723393-182723415 ACTTGAAACTTGGAAGTTGAGGG + Intronic
984726389 4:183025689-183025711 ACTTGAACCCGGGAAGTTGGTGG + Intergenic
985123366 4:186666158-186666180 ACATGTACCCTAGAACTTAAAGG + Intronic
986522979 5:8641688-8641710 ACATGAACTCTGGAACTTGATGG + Intergenic
988389610 5:30610543-30610565 ACATGTACCCTAAAACTTAAAGG + Intergenic
988393061 5:30660702-30660724 ACATGTACCCTAAAACTTAAAGG + Intergenic
988910485 5:35835930-35835952 ACATCTACCTAGAAAGTTGAGGG + Intergenic
990107441 5:52281526-52281548 ACATGTACCCTAAAACTTAAAGG + Intergenic
991660744 5:68948535-68948557 ACATGTACCCTTGAACTTAAAGG - Intergenic
992173762 5:74129174-74129196 ACATCTACTCTGGAAATTAATGG - Intergenic
992977148 5:82132268-82132290 ACATGTATCCCGGAACTTAAAGG - Intronic
993570776 5:89536189-89536211 ACAAGTTCCCTGGAAGTGCATGG + Intergenic
993955499 5:94227520-94227542 ACATGTACCCTAAAACTTAAAGG + Intronic
996370319 5:122746352-122746374 ACATGTAACCTGGAAGGTTCTGG + Intergenic
996983147 5:129524736-129524758 ACATGTATCCCAGAACTTGAAGG + Intronic
999665838 5:153912099-153912121 ACATGTACCCCTGAACTTAAAGG - Intergenic
1000697588 5:164407025-164407047 AAATGTGGCCTAGAAGTTGAAGG + Intergenic
1000823908 5:166020273-166020295 ACATGTACCCAAGATGTTCAGGG + Intergenic
1000858720 5:166431081-166431103 ATATGTGCCCTGGATGTTGCAGG + Intergenic
1001282148 5:170394108-170394130 ACATGTGCCATGGAAGGAGAGGG - Intronic
1003902047 6:10663412-10663434 ATATGTACCCCTGAACTTGAAGG - Intergenic
1004209827 6:13627952-13627974 ACATGTACCCTGGAACTTAAAGG + Intronic
1004477659 6:15988847-15988869 ACATGTTCCCTGGAGGATGTGGG + Intergenic
1006339814 6:33440636-33440658 GCATGTTCCCTGGAAGCTGAGGG + Intronic
1006741932 6:36315150-36315172 ACATGTACCCTAAAACTTAAAGG - Intergenic
1007185117 6:39964272-39964294 ACCTGTAACCTGGAAGTTTAGGG + Intergenic
1008238122 6:49074710-49074732 ACATGTACCCTAAAACTTAAAGG - Intergenic
1008493860 6:52113027-52113049 ACTTGGGCCCAGGAAGTTGAGGG + Intergenic
1009190981 6:60629811-60629833 ACATGTACCCTAAAACTTAAAGG - Intergenic
1010278384 6:73994991-73995013 ACATGCACCCTGGAACCTCATGG - Intergenic
1015292447 6:131553096-131553118 ACATGTATCCTGAAACTTAAAGG - Intergenic
1015405776 6:132835474-132835496 ACATGTAGACTGAATGTTGAAGG - Intergenic
1016145936 6:140673709-140673731 ACTTGAGCCCTGGAGGTTGAGGG - Intergenic
1016460361 6:144275033-144275055 CCAAGTACCCTGAAAGTGGAGGG - Intergenic
1016779100 6:147938912-147938934 ACATGAACCCCACAAGTTGAGGG + Intergenic
1017875467 6:158520771-158520793 ACAAGTTCCTTGAAAGTTGATGG - Intergenic
1018174492 6:161167160-161167182 AAATGGACTCTTGAAGTTGACGG + Intronic
1018582193 6:165317024-165317046 CCATCTACCCTGGAAGGGGAAGG - Intergenic
1019681382 7:2351988-2352010 ACTTGTACCCTGGAGGCAGAGGG - Intronic
1020696754 7:11422621-11422643 ACATGTACACAGATAGTTGAAGG + Intronic
1021391778 7:20102062-20102084 ACATGTACCCTAAAACTTAAAGG + Intergenic
1025950781 7:66143701-66143723 ACATGTACACTAGAAGCAGATGG + Intronic
1026523370 7:71134560-71134582 CCATATACCCTGCAAGTTCAAGG - Intronic
1029280312 7:99431210-99431232 ACTTGAACCCAGGAAGTGGAGGG - Intronic
1029802400 7:102962955-102962977 ACATGTACCCTAAAACTTAAAGG + Intronic
1030734789 7:113034848-113034870 ATAAGGACCCTGGAAGTGGAAGG + Intergenic
1031623610 7:123966889-123966911 ACATATACCCTGGAACTGGAAGG + Intronic
1031906456 7:127465210-127465232 ACATGTACCCTAAAACTTGAAGG + Intergenic
1033295096 7:140125647-140125669 ACTTGAGCCCAGGAAGTTGAGGG - Intronic
1035493880 7:159304484-159304506 ACATGTACCCTAAAACTTAAAGG + Intergenic
1036077186 8:5514881-5514903 ACATGTATCCTGGAAGATGATGG + Intergenic
1037668435 8:20993605-20993627 ACTTGAACCCTGGAAATGGAGGG + Intergenic
1037843021 8:22258955-22258977 ACATGAACCCAGGAAGTGGAGGG + Intergenic
1038918377 8:32053142-32053164 TCATGTCCCCTGGCAGTTAAGGG - Intronic
1039012869 8:33114313-33114335 ACATGTACCCCTGAACTTAAAGG + Intergenic
1039622670 8:39012918-39012940 ACATGTACCCTAGAACTTAAAGG + Intronic
1040070534 8:43183654-43183676 ACATATACCCTAGAACTTAAAGG - Intronic
1040581259 8:48700300-48700322 ACAACCATCCTGGAAGTTGACGG - Intergenic
1046943330 8:119952468-119952490 ACATGTATCTTGGAACTTTAGGG - Intronic
1048568433 8:135628713-135628735 GCATGTGCCCTGGAAGTTTCTGG - Intronic
1049713293 8:144077160-144077182 ACTTGAACCCTGGAGGTGGAGGG + Intergenic
1051817702 9:21129080-21129102 ACATGTACCCCAGAACTTAAAGG + Intergenic
1052595286 9:30550216-30550238 ACATATAGACTGGAAGTTGTTGG - Intergenic
1053178885 9:35950628-35950650 ACATGTACCCTAAAACTTAAAGG - Intergenic
1053407411 9:37889441-37889463 ACATGCACCTTGGAAGGTGGAGG + Intronic
1053639837 9:40061605-40061627 ACATGTACCCCTGAAATTAAAGG - Intergenic
1053766295 9:41403880-41403902 ACATGTACCCCTGAAATTAAAGG + Intergenic
1054320589 9:63657917-63657939 ACATGTACCCCTGAAATTAAAGG - Intergenic
1054544911 9:66315036-66315058 ACATGTACCCCTGAAATTAAAGG + Intergenic
1054719665 9:68592343-68592365 ACATGTACCCTAAAACTTAAAGG - Intergenic
1056524554 9:87431187-87431209 ACATGTACCCTGGAGCTTGAAGG - Intergenic
1058055595 9:100445639-100445661 ACAGGTACCCTGTAAGGTGTTGG - Intronic
1058090608 9:100801648-100801670 ACATGTACCCTAGAACTTAAAGG + Intergenic
1058856463 9:109067454-109067476 ACCTTTACCCAGGAAGGTGAAGG - Intronic
1060599120 9:124866319-124866341 ACCTGAACCCTGGAGGTGGAGGG + Intronic
1061767718 9:132892414-132892436 GCATGTACCCTGGAGAGTGAAGG + Exonic
1202787661 9_KI270719v1_random:44986-45008 ACATGTACCCCTGAAATTAAAGG - Intergenic
1185637603 X:1564577-1564599 ACACGTACCCTAGAACTTAAAGG + Intergenic
1188495786 X:30781675-30781697 ACATGTACCCCAGAACTTGATGG - Intergenic
1188606147 X:32032772-32032794 ACATTTGCCCAGGGAGTTGAGGG - Intronic
1188731709 X:33655314-33655336 ACATGTACATGGTAAGTTGAAGG - Intergenic
1188924336 X:36021383-36021405 ACTTGAACCCAGGAGGTTGAGGG - Intergenic
1193696434 X:84712288-84712310 ACTTGAACCCTGTAAGTTGGAGG - Intergenic
1193807296 X:86010326-86010348 ACATGTACCCTAGAACTTAAAGG + Intronic
1194844945 X:98794019-98794041 ACTTGAGCCCTGGAATTTGAGGG - Intergenic
1195173655 X:102294163-102294185 ACATGTACCCTAAAACTTAAAGG + Intergenic
1195185210 X:102392929-102392951 ACATGTACCCTAAAACTTAAAGG - Intronic
1195436190 X:104846215-104846237 ACATGTACCCTAGAACTTAAAGG - Intronic
1195973035 X:110494615-110494637 ACATGGGACATGGAAGTTGAAGG + Intergenic
1196067251 X:111477843-111477865 ACATGTATCCCAGAAGTTAAAGG + Intergenic
1196218747 X:113087351-113087373 TCATTGACCCTGGAAGTTGAAGG + Intergenic
1199396263 X:147342166-147342188 ACATATAACCTTGAACTTGAAGG - Intergenic
1200781767 Y:7223111-7223133 ACTTGAACCCAGGAGGTTGAGGG - Intergenic
1202091637 Y:21196862-21196884 ACATGTACCCTAGAACTTAAAGG + Intergenic
1202107026 Y:21382986-21383008 ACATGTACCCTAGAACTTACAGG - Exonic