ID: 1158926426

View in Genome Browser
Species Human (GRCh38)
Location 18:62267931-62267953
Sequence CCACACTCCCTCCCCAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 370}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158926423_1158926426 28 Left 1158926423 18:62267880-62267902 CCCTGTAATAATCTATGAATATA 0: 1
1: 0
2: 0
3: 36
4: 428
Right 1158926426 18:62267931-62267953 CCACACTCCCTCCCCAAAAAAGG 0: 1
1: 0
2: 1
3: 43
4: 370
1158926424_1158926426 27 Left 1158926424 18:62267881-62267903 CCTGTAATAATCTATGAATATAC 0: 1
1: 0
2: 3
3: 17
4: 244
Right 1158926426 18:62267931-62267953 CCACACTCCCTCCCCAAAAAAGG 0: 1
1: 0
2: 1
3: 43
4: 370
1158926422_1158926426 29 Left 1158926422 18:62267879-62267901 CCCCTGTAATAATCTATGAATAT 0: 1
1: 0
2: 1
3: 18
4: 249
Right 1158926426 18:62267931-62267953 CCACACTCCCTCCCCAAAAAAGG 0: 1
1: 0
2: 1
3: 43
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158926426 Original CRISPR CCACACTCCCTCCCCAAAAA AGG Intronic
900487321 1:2929336-2929358 CCACACTCTCTCCCCAGGGAGGG - Intergenic
901132793 1:6972860-6972882 CAACACTCCGTCTCAAAAAAGGG - Intronic
901140435 1:7025727-7025749 CCCCACTCCATCCCCAAAGCTGG - Intronic
901152322 1:7112100-7112122 CCACACAGCCTCCCCTACAAAGG - Intronic
901242534 1:7703988-7704010 CCGCACCCCCTCCCCAAAGCCGG + Intronic
902373060 1:16017363-16017385 CCCCACCCCCACCCCAGAAAAGG - Intronic
902532519 1:17099415-17099437 CCCCCATCCCTCCCAAAAAATGG + Intronic
903764873 1:25727703-25727725 CCACACTCCCTGCCCAGAACTGG - Intronic
903938418 1:26912275-26912297 CCACACTGCCTCTTCATAAATGG - Intronic
904326289 1:29728800-29728822 CCAAACTCCCTCCCCACAGCTGG + Intergenic
904403209 1:30270384-30270406 ACACAATCCCTCCCCCAAAGGGG + Intergenic
904851119 1:33460582-33460604 CCACTCTCCCATCCCCAAAAAGG - Intergenic
905416915 1:37810005-37810027 CCAGCCACCCTCCCCAAATAGGG + Exonic
906138925 1:43521754-43521776 TCTCACCCCCTCACCAAAAATGG - Intergenic
906303659 1:44702399-44702421 CCACTCTGCCTCTTCAAAAAAGG + Intronic
906451591 1:45953904-45953926 ACATATTCCCTCCCCAATAAAGG - Intronic
906583091 1:46952590-46952612 CAACACTCCCAACCCATAAAAGG - Intergenic
906699056 1:47844298-47844320 CCACCCTCCCTCCCCAACTCTGG - Intronic
907247601 1:53117943-53117965 CCTCCCTCCCTTCCCACAAATGG + Intronic
909438374 1:75670749-75670771 CCACACCCCCTCTTCAAAGAGGG + Intergenic
909476015 1:76081698-76081720 CCTCACTCCCACCCCCAAAAAGG - Intronic
909673337 1:78212598-78212620 CCACACTAGTTCCCCAACAATGG + Intergenic
910059573 1:83072992-83073014 CCTGACTCCCTTCCCCAAAATGG + Intergenic
911370549 1:96989661-96989683 CCACACCCCCTCCACAGAGAAGG + Intergenic
911370864 1:96993403-96993425 CCCCATTTTCTCCCCAAAAAGGG + Intergenic
911679167 1:100694580-100694602 CCACACTAACTCCCCAGCAATGG - Intergenic
913424240 1:118709021-118709043 CCAAACACCCTCCCCACAACAGG - Intergenic
914420230 1:147522245-147522267 CCATGTTCCCTCCCAAAAAAGGG - Intergenic
915598848 1:156909988-156910010 CCCCACTCCTTCTCCAAGAAGGG + Exonic
915722488 1:157994685-157994707 ACTCCTTCCCTCCCCAAAAATGG + Intronic
915914276 1:159931724-159931746 ACACCCTCCCTCCCACAAAATGG + Intronic
915931019 1:160061104-160061126 CCCCACTCCTTCCCAAAAAAAGG + Intronic
917506577 1:175632890-175632912 CCACACTGCCTCCCTATACAAGG + Intronic
917512971 1:175683452-175683474 CCACCATCCTTCTCCAAAAAAGG + Intronic
917562943 1:176178856-176178878 CCCCACTCCATCCCAAAAAAAGG + Intronic
917925474 1:179786077-179786099 CCCCACTCCCTTGCCAAAAAGGG + Intronic
918500043 1:185183978-185184000 CCCCACTCCCACTCCAAACAGGG + Intronic
923283638 1:232469031-232469053 CCACACTCCCACCCTACAGAGGG - Intronic
923653562 1:235896411-235896433 CCCCACTTCCTTGCCAAAAATGG + Intergenic
1063842995 10:10092658-10092680 CCACACACCCTCCCTCAAAAAGG - Intergenic
1063959552 10:11295866-11295888 CCAAACTCCCTCCACACAAGGGG - Intronic
1064701059 10:18022660-18022682 CCACACTAGCTCCCCAGTAATGG - Intronic
1065263481 10:23951144-23951166 CCACTCTGCCTCCCCAGAATGGG - Intronic
1065759795 10:28971502-28971524 CCTCACCTCCTCCCCTAAAAAGG - Intergenic
1067172868 10:43922293-43922315 CCTCCCTTCCTCCCCAAACACGG + Intergenic
1068633922 10:59327561-59327583 CCCCACCCCCCCACCAAAAAAGG + Intronic
1069461851 10:68603024-68603046 CCACTCTCCCTCCCAAACACAGG - Intronic
1069774310 10:70917963-70917985 CCCCACTCCCTCCCAAACCAGGG + Intergenic
1070033498 10:72699493-72699515 CAACACTCCGTCCCGGAAAAAGG + Intronic
1070042209 10:72792713-72792735 CCACCCACTCTCCCCAAAAGGGG + Intronic
1070666387 10:78348049-78348071 CCACACTCCCTCCCAAGTAGTGG + Intergenic
1071330407 10:84553138-84553160 ACAAACCCTCTCCCCAAAAAGGG - Intergenic
1071894563 10:90051519-90051541 CCACAATCCCTGCCCAGGAAGGG + Intergenic
1072791941 10:98324495-98324517 CGAGACTCCATCTCCAAAAAAGG - Intergenic
1073331345 10:102671871-102671893 CAGCACTCCCTGCCCAAAAAAGG - Intergenic
1074065436 10:110008476-110008498 CCCCACTCCCGCCCCGGAAAAGG - Intronic
1074111598 10:110426750-110426772 GCCCACTCCCTCCCCAAATGGGG - Intergenic
1074391260 10:113059898-113059920 ACACACACACACCCCAAAAATGG - Intronic
1075901338 10:126044968-126044990 CCACAGTCCCACCCTAACAAGGG - Intronic
1076300870 10:129425295-129425317 TCACACTCCTTCCTTAAAAAGGG + Intergenic
1076757029 10:132577872-132577894 CCACACTCCCTTCTCAAACCAGG - Intronic
1077219935 11:1411362-1411384 CCAGGCTCCCTCCCCAAACTAGG - Exonic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1078591677 11:12646407-12646429 CTCCACTCCTTCCCCAACAAAGG - Intergenic
1078729109 11:13959823-13959845 CAAAACTGCCTCCCCAAAGAAGG - Intergenic
1078730576 11:13970498-13970520 CCACACTCCTGCCCCACAGATGG - Intronic
1079719308 11:23790244-23790266 CCACACTCCCTGCACGCAAAGGG - Intergenic
1079747301 11:24149843-24149865 CCACACTAGCTCCTCAGAAATGG - Intergenic
1079970859 11:27032934-27032956 CCGCACTACCTCACCAACAAGGG + Intergenic
1080604295 11:33851959-33851981 CCACACCCACTCCCCATAATGGG - Intergenic
1080628287 11:34051361-34051383 CCCCACCCCCACCCCAAATAAGG + Intergenic
1080760967 11:35248375-35248397 TTACACTCCCTTCCTAAAAATGG + Intergenic
1080791596 11:35526395-35526417 CCTCACTGCCTCCACCAAAAGGG + Intronic
1081502366 11:43679592-43679614 CCCCACTCCCCAACCAAAAAAGG + Intronic
1082638698 11:55628373-55628395 CCACATTACTTCCCCAGAAATGG - Intergenic
1082931066 11:58606065-58606087 CCACACCCCCCCCACAAAAAAGG - Intronic
1083596557 11:63920568-63920590 CCACACTCCCTCCCCAACCCCGG - Intergenic
1084878217 11:72149816-72149838 CCTGGATCCCTCCCCAAAAAAGG - Intergenic
1084949433 11:72656568-72656590 CCCCACTCCCACCCCCAAACAGG + Intronic
1086096254 11:83052783-83052805 CCCTTCTCCCTCCCCAACAAAGG - Intronic
1086144083 11:83531977-83531999 CCACCCTCCCACCCCAACATAGG - Intronic
1088387383 11:109274977-109274999 TCACACTAGCTCACCAAAAATGG - Intergenic
1089318109 11:117605824-117605846 CCACACCCCCACACCCAAAATGG - Intronic
1089670820 11:120055908-120055930 CCTCACTCCCACCCCAGGAAGGG + Intergenic
1090807503 11:130211578-130211600 CAACACTCCCTCCCTCAAAGAGG - Intergenic
1091842939 12:3633549-3633571 ACAAACTCCCTTCCCAAAGATGG + Intronic
1091857366 12:3750787-3750809 CAACCCTCCCTCCCCACAACAGG + Intronic
1096295688 12:50382001-50382023 CCCCACTCCCTACTCAAAAGGGG - Intronic
1097507763 12:60497730-60497752 CCCCACTCCCACCCCACAACAGG - Intergenic
1098258916 12:68647390-68647412 CCCCCCCCCCCCCCCAAAAAAGG + Intronic
1098602571 12:72349543-72349565 CCACCCCCCCGCCCAAAAAAAGG - Intronic
1099796051 12:87400934-87400956 CCAAACTCCCTCTCAAAACAAGG - Intergenic
1099989376 12:89707895-89707917 ACAGACTCCTTCCTCAAAAAGGG + Intronic
1104873847 12:132019328-132019350 CCACACGCCCGGCCTAAAAATGG + Intronic
1105941995 13:25156007-25156029 TGGCACTCCCACCCCAAAAAAGG + Intergenic
1106060068 13:26281603-26281625 CCACACTAGCTCCCCAGCAATGG + Intronic
1106659129 13:31780065-31780087 CTGCTCTCCCTCCCCAAAAGGGG + Intronic
1107927767 13:45279912-45279934 CCCCCCGCCCCCCCCAAAAAAGG + Intronic
1110048763 13:70866652-70866674 CTAAACTCCCCCCCCAAAAAAGG + Intergenic
1110264706 13:73524149-73524171 CCATGCTCCCTGCCCAAAAGTGG - Intergenic
1110491914 13:76119119-76119141 TCACACTCACTCCCCAGCAATGG + Intergenic
1112148445 13:96729157-96729179 CCACACTCCCACCCCACTAATGG - Intronic
1112561831 13:100521980-100522002 CCACCCTTCTTCCCCAAAAAGGG + Intronic
1113331803 13:109334528-109334550 CTACACTCCCTCTCCAGAGAGGG - Intergenic
1113591937 13:111507418-111507440 CCACAGTCCATCCCAAACAAAGG - Intergenic
1113654084 13:112057328-112057350 CCCTCCCCCCTCCCCAAAAATGG - Intergenic
1114969223 14:28005082-28005104 TCACACTAGCTCCCCGAAAATGG - Intergenic
1115275540 14:31604697-31604719 CCCCCCACCCTCCCAAAAAAAGG - Intronic
1115674958 14:35662930-35662952 TCCCACCCCCCCCCCAAAAAAGG - Intronic
1116687752 14:48063114-48063136 CAACACTTCCTCCTCAATAATGG + Intergenic
1117193324 14:53315757-53315779 CCACATTACCTCCCCAGCAATGG - Intergenic
1118770592 14:68940209-68940231 GCACATTCCTTCCCCAAAGAAGG + Intronic
1118857850 14:69637826-69637848 CCACACTCCCTCCCCTGCACAGG - Intronic
1119198770 14:72737689-72737711 ACACACTGCCTCCCGAAAGATGG - Intronic
1121250444 14:92495785-92495807 CCACACTCACTCCCCAAGTGTGG - Exonic
1121458666 14:94056122-94056144 CCCAGCTCCTTCCCCAAAAAAGG + Intronic
1122138862 14:99650282-99650304 ACACACTCCCTCCCCTCACAGGG - Intronic
1123043270 14:105499263-105499285 CCACGCTCCCACCCCCAAACAGG - Intronic
1123061906 14:105598296-105598318 CCCCACGCCCTCCCCAGAGAAGG + Intergenic
1123086649 14:105720027-105720049 CCCCACGCCCTCCCCAGAGAAGG + Intergenic
1124071025 15:26393340-26393362 CCACACTCCCACCCCACCAGTGG - Intergenic
1125346979 15:38728248-38728270 TTACACTCACTCCCCTAAAATGG + Intergenic
1127188844 15:56507899-56507921 CCACATCACCTCCCCAACAAGGG + Intergenic
1127340966 15:58043716-58043738 CCTCCCTCCCTGCCAAAAAACGG + Intronic
1128109364 15:65067180-65067202 CCACACCCCCTCCCCGTAGAAGG - Intronic
1128801554 15:70500344-70500366 CCCCTCTCCCTCACCAAGAAAGG + Intergenic
1129269280 15:74410980-74411002 CCCCACTGCCTCCCCAGACAAGG - Exonic
1129826611 15:78638689-78638711 CCCCACTTGCCCCCCAAAAAGGG + Intronic
1130663891 15:85853224-85853246 CCACACTCCATCCACTAACAAGG - Intergenic
1131789586 15:95949430-95949452 CCCCACCCCCCCCCAAAAAATGG - Intergenic
1132728088 16:1347381-1347403 CCACACCCCCGCCCCACAGAGGG - Intronic
1133474424 16:6106677-6106699 CGACACTCCGTCTCAAAAAAAGG - Intronic
1133520102 16:6549061-6549083 CAAGACTCTGTCCCCAAAAAAGG + Intronic
1134010004 16:10844884-10844906 CGAGACTCCATCTCCAAAAAAGG - Intergenic
1134531053 16:14984176-14984198 CTACCCACCCACCCCAAAAAAGG + Intronic
1136395991 16:29992812-29992834 CCACACACCCTTCTCCAAAAGGG + Exonic
1136527961 16:30845065-30845087 CCACGTTCCCTCCCCCAATATGG + Intronic
1137248221 16:46722707-46722729 CCCCACCCCCACCCCAAAAAAGG - Intronic
1137399218 16:48139707-48139729 CCACACTCCTTCCACAAAGGAGG - Intronic
1137706058 16:50536592-50536614 CCAGACTCCATCTCAAAAAAAGG + Intergenic
1138358308 16:56404014-56404036 CCTCCCTCCCCCCTCAAAAAGGG - Intronic
1139865296 16:70056853-70056875 CTACCCACCCACCCCAAAAAAGG - Intergenic
1140452297 16:75080654-75080676 CCACACACACTCCATAAAAAAGG + Intronic
1142759766 17:2035513-2035535 CCCCACTCCCTCCCCACCACAGG - Intronic
1143030167 17:3963508-3963530 CCTCCCTCCCTCCCCAGAGATGG + Intronic
1143791016 17:9295739-9295761 CCCCCCTCCCCCCCAAAAAAAGG + Intronic
1144128718 17:12225465-12225487 CCACAGTCCTTCCCCCAAAGAGG + Intergenic
1144495230 17:15741568-15741590 CCACCCTCCCTCCCTACAGATGG + Intronic
1144531941 17:16047947-16047969 CATCACTCCCTCTCCAAAAATGG + Intronic
1145411674 17:22671080-22671102 CCTGACTCCATTCCCAAAAAAGG - Intergenic
1145916474 17:28576961-28576983 CCACACCCCCTCCCCAGGACTGG + Exonic
1145966018 17:28917835-28917857 CCACACTCCCTTCCCAGGAAGGG + Intronic
1146679736 17:34798481-34798503 CCACCCCCCCACCCCAATAAAGG + Intergenic
1146849753 17:36211952-36211974 CATCACCCCCTCCCCAAAACAGG - Intronic
1147578226 17:41614576-41614598 CCTCACCCCTACCCCAAAAAGGG + Intronic
1147614442 17:41819903-41819925 CCACCCTCCCTCCCCAAACTTGG - Intronic
1147878744 17:43640552-43640574 CCACCTCCCCACCCCAAAAAGGG - Exonic
1148462052 17:47844535-47844557 CCTCACTCCATCCCCATAGAGGG - Intergenic
1148689298 17:49517588-49517610 CTACACTCCGTCTCAAAAAAAGG + Intergenic
1149569833 17:57664504-57664526 CAAGACTCCCTCTCAAAAAAGGG + Intronic
1149806882 17:59626538-59626560 CAACACTACCACCCTAAAAAAGG - Intronic
1150584762 17:66507445-66507467 CCAGACTCCACCCACAAAAATGG - Intronic
1152366417 17:79859181-79859203 CCTCACTCCCTCCCCTGAAAGGG - Intergenic
1153087300 18:1302944-1302966 CCATAAGCCCTCCCCAGAAAAGG - Intergenic
1153466883 18:5397941-5397963 ACACACTCACGCCCAAAAAAAGG + Intronic
1153500617 18:5745705-5745727 CCACCCACCCCCGCCAAAAAAGG - Intergenic
1153828874 18:8901802-8901824 CCACACTGGCTCCCCAGCAAGGG + Intergenic
1155465877 18:26134563-26134585 CCACACCTGCTCCCCAAATACGG + Intronic
1155970914 18:32082894-32082916 CCATCCTCTCTCCCCAAACAGGG + Intergenic
1158800134 18:60896547-60896569 GCACACACCCTCCCCCAACATGG + Intergenic
1158926426 18:62267931-62267953 CCACACTCCCTCCCCAAAAAAGG + Intronic
1159723267 18:71920008-71920030 CCACACTAACTCTCCAGAAATGG + Intergenic
1160622109 18:80178893-80178915 CCTCACTCCCTCCCCAGAAGAGG - Intronic
1161828492 19:6585916-6585938 CCACACTCCCACCCCAACCCCGG + Exonic
1162359859 19:10212468-10212490 CACCACACCCTGCCCAAAAAAGG + Intronic
1162636727 19:11974600-11974622 CCACCCCCCCGCCCAAAAAAAGG - Intronic
1163315631 19:16538779-16538801 CCACCCCCCCGCCCCAGAAAGGG + Intronic
1164816091 19:31204443-31204465 CCACACCCCTCCCCCAAAAAGGG - Intergenic
1165638413 19:37363449-37363471 CCACACTCCCTGCACATAAAAGG - Exonic
1165782447 19:38442262-38442284 CCACACTCCCTCCCCTAGTCTGG - Intronic
1166262853 19:41653561-41653583 TCACACTAGCTCACCAAAAATGG + Intronic
1166810746 19:45513235-45513257 CAAGACTCCCTCACAAAAAAAGG - Intronic
1166857658 19:45791307-45791329 CCACAGTGCCTCCCCAAAGTTGG + Intronic
1168048117 19:53808680-53808702 CCACACTCTCTCAAGAAAAAGGG + Intronic
925089931 2:1146848-1146870 CCTTACACCCTCCCTAAAAATGG + Intronic
925687831 2:6491684-6491706 CCACTCTCCCTCCCCGACAGTGG + Intergenic
926695504 2:15767727-15767749 CCACCCTCCTTCCCCTAACATGG + Intergenic
927272439 2:21226797-21226819 CCACTCTCCATCCCAAAATATGG - Intergenic
927656289 2:24949347-24949369 CCACTCTGCCTCCCCAGAGAGGG + Intronic
927710502 2:25322758-25322780 CCACAGTCTCTCCTCAACAAGGG + Intronic
928405830 2:31014259-31014281 TCCCCCTTCCTCCCCAAAAAAGG + Intronic
928465863 2:31521846-31521868 CCAGACGCACTCCCCAAAAAAGG - Intergenic
931939411 2:67235365-67235387 TCACTCTCCTTCCCCAAATAGGG + Intergenic
932278161 2:70467034-70467056 CCCAACACCCTCCCCCAAAAGGG - Intronic
934525777 2:95050728-95050750 CTACAATCGCTCCCCTAAAAAGG + Intronic
935121645 2:100188231-100188253 ACCCCCTCCCTCCCAAAAAAAGG - Intergenic
935594981 2:104871368-104871390 CCGCACTCCTTCCCCAAAATAGG - Intergenic
936726510 2:115324262-115324284 CGACACTCCGTCTCAAAAAAAGG + Intronic
937234775 2:120424119-120424141 CCACACACCCTGGCCAAGAAGGG + Intergenic
938286351 2:130120735-130120757 CCCCACGCCCACCCCAGAAAGGG + Intronic
938429256 2:131218161-131218183 CCCCACGCCCACCCCAGAAAGGG - Exonic
939016713 2:136912390-136912412 CGAGACTCCCTCTCAAAAAAAGG + Intronic
939399263 2:141669743-141669765 CCACCCGCCCCCGCCAAAAAAGG - Intronic
939511513 2:143111524-143111546 CCACAATCCATCCACCAAAATGG + Intronic
939684112 2:145176276-145176298 ACACAATCCCTCTCCACAAAAGG + Intergenic
941560798 2:167041288-167041310 CCACACTAGCTCCCCAGCAATGG + Intronic
945008832 2:205440063-205440085 TCACATTCCCTCCCCACAGATGG - Intronic
945198618 2:207260056-207260078 CCACACCCTCTCTCCAAAAAAGG + Intergenic
945285570 2:208078268-208078290 CCACACCCCCTCCCCCAAGGTGG + Intergenic
945526049 2:210888807-210888829 CCACACTAACTCCCCAGCAATGG + Intergenic
948864508 2:240768483-240768505 CCACACACCCACCCCAAAGATGG - Intronic
949031231 2:241798446-241798468 CCACCCTCGCTCCCCATATAGGG - Intronic
1168827149 20:821689-821711 CCCCACTCCCACGCCAAACAGGG + Intergenic
1168848429 20:960553-960575 CCCCACCCACTCCCCAACAACGG + Intronic
1169039842 20:2483969-2483991 CCACACTCCCTGCACAAATAAGG + Exonic
1169591765 20:7150788-7150810 CCACAGTGCCTGGCCAAAAAAGG + Intergenic
1169655914 20:7922894-7922916 CCCCACTCCATCTCAAAAAATGG + Intronic
1170658713 20:18315656-18315678 CCACACTCCCTGCACACAATTGG - Exonic
1170865433 20:20151018-20151040 CCACACTAGCTCCCCAGCAATGG + Intronic
1171260951 20:23734079-23734101 CCACACTAACTCTCCAGAAATGG - Intergenic
1171270068 20:23809921-23809943 CCACACTAACTCTCCAGAAATGG - Intergenic
1171510217 20:25676311-25676333 CCACACTCCTTGCACACAAAAGG + Exonic
1174760641 20:53203612-53203634 CCACACTGCCTCCCCTAGGAGGG + Intronic
1175218567 20:57404387-57404409 CCACACACCTTCTCCAAACATGG - Intronic
1175322236 20:58097216-58097238 CCACAGTCCTTCACCAAACAAGG + Intergenic
1177657375 21:24035830-24035852 CCACACTAGCTCCCCAGCAATGG + Intergenic
1178788168 21:35673652-35673674 CCACACACCCTGCCAAACAAGGG + Intronic
1179192810 21:39137535-39137557 CCGCTCTCCCTCCCCAGAAATGG - Intergenic
1179473528 21:41628287-41628309 CCACACTCACTCCAGACAAACGG - Intergenic
1179795111 21:43778060-43778082 CCCCACCCCCACCCCAAATAAGG - Intergenic
1179927923 21:44548434-44548456 CCACCCACCCACCCCAACAAAGG - Intronic
1181474264 22:23158842-23158864 CCATCCTCCCACCCCAAACAGGG - Intronic
1182145948 22:27996749-27996771 CCACACTCCCTTCCGAAACAGGG + Intronic
1184812789 22:46848192-46848214 CCCCACTCCCTCCAAAAAAATGG + Intronic
949888485 3:8714512-8714534 CCACCCTCCCTCTCCAAAGGTGG - Intronic
950188896 3:10962757-10962779 CCACCTTCCCACCCCAAAAAAGG + Intergenic
950313810 3:11982667-11982689 CCACACTCCTTCTCCTTAAAGGG + Intergenic
950717287 3:14858230-14858252 TCACACTCACTCACCAAATATGG - Intronic
950717474 3:14859876-14859898 AACCACTCCCCCCCCAAAAAGGG + Intronic
950890580 3:16400652-16400674 TCTCAATCACTCCCCAAAAAAGG - Intronic
951206727 3:19933615-19933637 CCACACACCCTGCCCAAAGGAGG + Exonic
952010692 3:28897626-28897648 CCAGACTCCATCTCAAAAAAAGG - Intergenic
952783257 3:37125698-37125720 TCACACTCCCACCCAAAAAAAGG + Intronic
952823457 3:37505130-37505152 CCACACTCCCTCCTACAAGAAGG - Intronic
952872074 3:37909776-37909798 CCTCATTCCCTCCCCAAATGTGG - Intronic
953001806 3:38941089-38941111 CCCCACTCCCACCCCAACACTGG + Intronic
953706664 3:45236391-45236413 CCACACACACACCCCCAAAAGGG + Intergenic
954459982 3:50620809-50620831 CCATACACCCTCTCCAAGAAAGG - Intronic
954480510 3:50796019-50796041 CCACACCACCTCTCCAGAAAGGG - Intronic
955699166 3:61666398-61666420 CCACACACCCTTCCCAGAAGGGG - Intronic
955715251 3:61822845-61822867 CCTCATACCTTCCCCAAAAAAGG + Intronic
956267182 3:67409894-67409916 CCATACTTCCTCCCAAAACAAGG + Intronic
956664318 3:71627874-71627896 CCACCCTCCTTCCCAAAACAGGG - Intergenic
957185646 3:76938353-76938375 CCACCTACCCCCCCCAAAAAAGG + Intronic
957281536 3:78156252-78156274 TCACACTACCTCTCCAATAATGG + Intergenic
958163893 3:89854102-89854124 CCCTACTCCTTCTCCAAAAAAGG - Intergenic
958790186 3:98643477-98643499 CCACACTAGCTCCCCATCAATGG - Intergenic
959778536 3:110200140-110200162 CCACACCACCTCCCCAGCAAGGG + Intergenic
960298814 3:115976653-115976675 CCACATTCCTTCCCCAACATTGG - Intronic
961440616 3:126950866-126950888 CATCACTCCCTTCCCAACAATGG - Intronic
961452074 3:127006739-127006761 ACACACTCCCTGCCCAAGCAGGG - Intronic
962450363 3:135509639-135509661 CCAGACCCCCCCCCAAAAAAAGG + Intergenic
962925439 3:139988980-139989002 CCATACTCCCTCCTCAGCAAGGG + Intronic
962998840 3:140657036-140657058 CCACAATCCCTCTCCAGCAAGGG + Intergenic
963144568 3:141979598-141979620 CGAAACTCTCTCTCCAAAAAAGG - Intronic
963202346 3:142598316-142598338 CCCCACTCCCTCCCACAAACAGG - Intronic
964618917 3:158700896-158700918 CCACCCTGCTTCCCCCAAAAGGG + Intronic
965171156 3:165265882-165265904 TGAGACTCCGTCCCCAAAAAAGG - Intergenic
966553164 3:181228921-181228943 TCACACTAGCTCCCCAACAATGG - Intergenic
967434529 3:189429407-189429429 CTTCACACCCTCCCAAAAAAAGG + Intergenic
968501252 4:951275-951297 CCAGAGTCACTCCCCAGAAAAGG - Intronic
968978900 4:3836265-3836287 CTGCACTCCCTCCTCCAAAACGG - Intergenic
970982291 4:22113918-22113940 CCACACTCCTTTCTCATAAAGGG + Intergenic
972363577 4:38351554-38351576 CCACACTAGCTCCCCAGCAATGG + Intergenic
973091676 4:46145660-46145682 TCACACTACCTCCCCAACAATGG - Intergenic
973257747 4:48129966-48129988 CCACACTCCCTGCCCACCGAGGG - Intronic
973779848 4:54278085-54278107 CCACTCTCCATCCCCACACATGG + Intronic
973827460 4:54723071-54723093 CCACCCTTCCACCCCCAAAAAGG + Intronic
974358783 4:60847912-60847934 CCACACTCCCTCCCCTCCTAAGG + Intergenic
975318392 4:72981301-72981323 CCACTCTCCTTCCCAAAAACTGG - Intergenic
975487753 4:74953011-74953033 TCACTTTCCCTCCCCACAAAAGG + Intronic
975619031 4:76277037-76277059 CCACACTGTCTCACCACAAAAGG - Intronic
976215370 4:82710789-82710811 CCTCTCTCCCTCTCCAACAATGG - Intronic
976852132 4:89559850-89559872 CCCCAGACCCTCGCCAAAAAAGG - Intergenic
977043788 4:92044915-92044937 CCACACCCCCGCCCCAACAGTGG - Intergenic
977855550 4:101886291-101886313 TCCCACTGCCTCCTCAAAAAGGG - Intronic
978156678 4:105497163-105497185 CCACCCCCCCCCCCCAACAATGG - Intergenic
978680168 4:111370361-111370383 CCCCACCCCCACCCCAAAACAGG - Intergenic
979615075 4:122733140-122733162 CCAGAATCCCTGCCCAAAACAGG - Intronic
979712580 4:123797665-123797687 CCACACTAGCTTCCCAAAAGTGG - Intergenic
979953473 4:126924798-126924820 CAAGACTCCTTCCCCTAAAATGG - Intergenic
979986319 4:127320085-127320107 CCTCACTGCCCCTCCAAAAATGG + Intergenic
980257515 4:130401926-130401948 CCACAGTACCTCTCCAGAAAGGG - Intergenic
980391984 4:132158911-132158933 CCACACTAGCTCTCCAACAATGG - Intergenic
981342431 4:143637448-143637470 CCATATTCCCTTCCCAAATAAGG + Intronic
981884289 4:149654291-149654313 CCACACCCCATCTCCAACAATGG - Intergenic
983785034 4:171719430-171719452 CCACACTCGCTCCCCAGAAATGG + Intergenic
983876060 4:172875555-172875577 CCACACTCCACTCCTAAAAATGG - Intronic
984491791 4:180443362-180443384 CCCTACACCCTCCCAAAAAATGG + Intergenic
984779060 4:183506779-183506801 CCCCACCCCCTCCCCAAACACGG - Intronic
984838348 4:184043367-184043389 CCACTCTCCCTTCCCACACATGG + Intergenic
985913539 5:2900941-2900963 TCACACTCCTTCCCTACAAAGGG - Intergenic
988326598 5:29776657-29776679 ACAATCCCCCTCCCCAAAAAAGG - Intergenic
990859831 5:60314634-60314656 CCACACCCCCACCCCACAACAGG + Intronic
990956408 5:61344524-61344546 CCTCACCCCATCCCCAAGAAAGG - Intronic
991543282 5:67752797-67752819 CCACACTACCTCCCCAGTAATGG + Intergenic
993651180 5:90524602-90524624 CGAGACTCCGTCTCCAAAAAAGG - Intronic
994329166 5:98486236-98486258 CCACATCCCCTGCCCAAAAGGGG + Intergenic
994850146 5:105044537-105044559 AAAAACTCCCTCCCAAAAAAAGG + Intergenic
995258527 5:110074803-110074825 CCACACTACCTCTCCAGCAAGGG - Intergenic
997224711 5:132200546-132200568 CCCCACTCCCCCCAAAAAAAAGG - Intronic
997229811 5:132234141-132234163 CCACTCCCCTTCCCCAAAACAGG - Intronic
997738910 5:136236584-136236606 CCACATTCCCTCCCAGAGAAGGG - Intronic
998252782 5:140563986-140564008 CCCCTCTCCATCCCCAAAATGGG + Intronic
998694485 5:144623960-144623982 CCCCACTCCCACCCCAAAACAGG + Intergenic
998907456 5:146921762-146921784 CCACACCTCCTCCCCTAGAAAGG + Intronic
1000032054 5:157410677-157410699 CAAGACTCCATCTCCAAAAAAGG + Intronic
1002066924 5:176656564-176656586 CCACAGTCCCTCCACAAAGCCGG - Intronic
1002087371 5:176784672-176784694 CCCAACTCCCTCCCCAAGTAGGG - Intergenic
1002155915 5:177279484-177279506 CTAGACTCCCTCTCAAAAAAAGG + Intronic
1002301569 5:178260106-178260128 ACCCACACCCTCCCCAAAGAGGG + Intronic
1002445824 5:179289138-179289160 CCACACTCCCTGCTCAGAGACGG + Intronic
1002884010 6:1277758-1277780 CCACACTCCCTCCCAGATCAAGG + Intergenic
1004484123 6:16049551-16049573 CCAAACTGCCACCCCAAAACTGG - Intergenic
1005219312 6:23568007-23568029 CCTCACTCCATGACCAAAAAAGG + Intergenic
1006902486 6:37512133-37512155 GCACACTGCCTCCCCGAGAAAGG + Intergenic
1007438710 6:41838733-41838755 CCACACTAGCTCCCCAACAATGG + Intronic
1008904459 6:56661132-56661154 AAATACACCCTCCCCAAAAAGGG + Intronic
1009226120 6:61021528-61021550 CCCTACTCCCACCCCAAAACAGG + Intergenic
1009248083 6:61264482-61264504 CCATACTACCTCCCCAGCAACGG - Intergenic
1010654986 6:78502151-78502173 CCATACTATCTCCCCAGAAATGG - Intergenic
1010692352 6:78925162-78925184 CCATACCCCCACCCCAAAACAGG - Intronic
1011378851 6:86720752-86720774 CCACCCTACCACCCCAACAAAGG + Intergenic
1011521209 6:88208948-88208970 CCACACTCCCTCCCCACGATGGG + Intergenic
1012335855 6:98056627-98056649 CCAAAATCTCTCCCTAAAAATGG + Intergenic
1012827022 6:104159244-104159266 CTACCCTCCCTACCCAAAGATGG - Intergenic
1013206427 6:107950343-107950365 ACACCCTCCATCCCCAAAAATGG + Intronic
1013745034 6:113335203-113335225 CCCCACCCCCCCCCAAAAAAAGG - Intergenic
1015678988 6:135782312-135782334 CCACACTACCTCTCCAGCAAGGG + Intergenic
1015819802 6:137248658-137248680 CCAAACTACCTCCTCATAAATGG + Intergenic
1016237739 6:141888199-141888221 CCACACTAGTTCCCCATAAATGG + Intergenic
1017145380 6:151229984-151230006 CCTCACCCCCACCCCACAAAGGG + Intergenic
1018147057 6:160901151-160901173 CCACACTAGCTCCCCAGCAATGG + Intergenic
1018781672 6:167073549-167073571 CCACACTAGCTCCCCAGCAATGG - Intergenic
1018933116 6:168255151-168255173 ACAAACTCCCTCCCCAGAAGAGG - Intergenic
1019199912 6:170306241-170306263 CCCCGCTCCCTCCCCAAACGTGG + Intronic
1019737832 7:2659312-2659334 CCACTCTCCTTCCCCAGGAAAGG - Intronic
1020004939 7:4777743-4777765 CCACACTCTATCCTCAAAAACGG - Intronic
1021643214 7:22761064-22761086 CCCCACTACCTCCCCCAACATGG - Intergenic
1023165881 7:37343296-37343318 CCATACTCCCTCCCCAAGGTCGG + Intronic
1024842633 7:53604242-53604264 ACACACTACTTCCCCAGAAATGG + Intergenic
1024966021 7:55022409-55022431 CCACCCTCCCTCCTCAAAGGAGG + Intronic
1025947343 7:66114765-66114787 CCACCCTGCCCCCCGAAAAAGGG + Exonic
1026739092 7:72967239-72967261 CCCCCCACCCCCCCCAAAAAAGG - Intronic
1027104639 7:75397834-75397856 CCCCCCACCCCCCCCAAAAAAGG + Intronic
1027468107 7:78540259-78540281 CCACACCCCATCCCCAACAGTGG - Intronic
1028554579 7:92108404-92108426 CTCCACTCCCTTCCCCAAAAAGG - Intronic
1028936763 7:96473789-96473811 CCACACTAGCTCACCAACAATGG - Intergenic
1031589627 7:123573637-123573659 TCAGACTCCCTCCTCAAGAAAGG - Intronic
1033143224 7:138846674-138846696 AGACACGCCCTCCCCCAAAAGGG + Intronic
1034132158 7:148729445-148729467 CCAGATTCCCTCCTTAAAAAGGG + Intronic
1034386335 7:150744165-150744187 CCACACTCCCTCTACTAACAAGG - Intronic
1034551390 7:151822828-151822850 ACTCCCTCCCTCCCCACAAAAGG + Intronic
1035399320 7:158554674-158554696 CCACTCCCCCTCCACCAAAAAGG - Intronic
1035842666 8:2829150-2829172 CCACCCACCCTCCCCAGAATGGG - Intergenic
1036485605 8:9175980-9176002 CCACCCTCCCACCCCAAGACAGG + Intergenic
1037442730 8:18933297-18933319 CCAAACTCACTCACCAAATAAGG + Intronic
1037589271 8:20299748-20299770 CCAGATTACCTCCCCAAACATGG + Intronic
1037951629 8:23022255-23022277 CCGCACCCCCCACCCAAAAAAGG + Exonic
1038893831 8:31758207-31758229 CTAGACTCCCACCCCACAAAAGG + Intronic
1042084310 8:65090540-65090562 CCACACTAGCTCCCCAGCAATGG + Intergenic
1043677827 8:82981513-82981535 AAATACTTCCTCCCCAAAAATGG + Intergenic
1043738476 8:83776212-83776234 CCACACTAGTTCCCCAGAAATGG + Intergenic
1043949554 8:86292377-86292399 CCATCCCCCCTCCCCCAAAAAGG + Intronic
1044740916 8:95325574-95325596 TCACAATCCCTCCTCAACAAAGG + Intergenic
1044752812 8:95432211-95432233 CCACCCTCCCTCCCACAAAAGGG - Intergenic
1044873274 8:96641209-96641231 CCACAACCCCTCCCCAGCAAGGG - Intergenic
1045081064 8:98626294-98626316 AAACACTCTCTTCCCAAAAAAGG + Intronic
1046230443 8:111348543-111348565 CCCCACCGCCTCCCCCAAAATGG - Intergenic
1046886935 8:119377453-119377475 CCACAGTTCCTCCCCAACAAGGG + Intergenic
1047544215 8:125799396-125799418 ACACACTTCTTCCCCAAAAGAGG - Intergenic
1048611615 8:136029007-136029029 CCACACTCCATCTCCAAGCAAGG - Intergenic
1052650163 9:31291640-31291662 GCACACTAGCTCCCCAACAATGG + Intergenic
1053840090 9:42183553-42183575 CCACTGCCCCTCCCCAACAAAGG + Intergenic
1054097141 9:60914301-60914323 CCACTGCCCCTCCCCAACAAAGG + Intergenic
1054118547 9:61189930-61189952 CCACTGCCCCTCCCCAACAAAGG + Intergenic
1054589210 9:66992634-66992656 CCACTGCCCCTCCCCAACAAAGG - Intergenic
1056598037 9:88023791-88023813 CAACACTCCGTCTCAAAAAAAGG - Intergenic
1056757695 9:89392182-89392204 CCCCACTAACCCCCCAAAAATGG - Intronic
1057904910 9:98975832-98975854 CCACTCTCACTCTGCAAAAAGGG - Intronic
1058464510 9:105214281-105214303 CAAGACTCCCTCTCAAAAAAAGG + Intergenic
1059222184 9:112634237-112634259 CAAAACTCCATCCCAAAAAAAGG - Intronic
1060206437 9:121685266-121685288 CAACACTCCCTCTGCAGAAAAGG - Intronic
1060883533 9:127135140-127135162 TCAATCTCCCTCCCCAAAGAGGG - Intronic
1061545567 9:131302291-131302313 CCCCACCACTTCCCCAAAAATGG - Intronic
1062168858 9:135122959-135122981 CCCCACTCCCTCCCAAATATCGG - Intergenic
1062325645 9:136011219-136011241 CCTCCCACCCTCCCCAAGAAGGG + Exonic
1188147260 X:26629661-26629683 TCACACTGGCTCCCTAAAAATGG - Intergenic
1189170666 X:38906295-38906317 CCACACTTCACCCCCAAAAGAGG - Intergenic
1189442213 X:41047928-41047950 CCACACTCACTCCCCATGAGGGG - Intergenic
1189678432 X:43487786-43487808 CCACACTGGTTCCCCAACAATGG + Intergenic
1192036821 X:67572254-67572276 TCAGCCTCCCTCCCCAGAAAAGG - Intronic
1193188727 X:78544602-78544624 CCACACTAACTCCCCAACAATGG - Intergenic
1193339167 X:80325419-80325441 CCATACCCCCACCCCAAAACAGG - Intergenic
1193365240 X:80623604-80623626 CCCCACTCCCTAGCCAAAACAGG - Intergenic
1193499574 X:82258798-82258820 CCACACTAGTTCCCCAGAAATGG - Intergenic
1193883700 X:86959561-86959583 CTACACTGCCTCTCCAACAAAGG - Intergenic
1194012918 X:88584337-88584359 CCACCCTCCCTTGCCAAACAAGG + Intergenic
1195668077 X:107448668-107448690 CCACTCTTCCTTCCCCAAAAAGG - Intergenic
1195676912 X:107513514-107513536 CCACTGTCACTCCCCTAAAAAGG + Intergenic
1196268513 X:113682152-113682174 CCACACTCTCTACCCAGAAGGGG + Intergenic
1197110369 X:122766159-122766181 CTACACTCCCTCCAAAAAAAAGG + Intergenic
1197177240 X:123499399-123499421 CCACACTAACTCCCCAGCAATGG - Intergenic
1201018591 Y:9628424-9628446 CCACCCCACCCCCCCAAAAAAGG + Intergenic
1201927860 Y:19309135-19309157 GCACACTACCTCCCCAGAAATGG + Intergenic