ID: 1158926569

View in Genome Browser
Species Human (GRCh38)
Location 18:62270139-62270161
Sequence CTGCTGCTTCAGAAGCCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 1, 2: 3, 3: 25, 4: 314}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158926569_1158926570 -1 Left 1158926569 18:62270139-62270161 CCACATGGCTTCTGAAGCAGCAG 0: 1
1: 1
2: 3
3: 25
4: 314
Right 1158926570 18:62270161-62270183 GAGCCAGACTTATCACATAGTGG 0: 1
1: 0
2: 0
3: 8
4: 87
1158926569_1158926572 24 Left 1158926569 18:62270139-62270161 CCACATGGCTTCTGAAGCAGCAG 0: 1
1: 1
2: 3
3: 25
4: 314
Right 1158926572 18:62270186-62270208 AACGCCTCCCAAGAATGAAAAGG 0: 1
1: 0
2: 0
3: 10
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158926569 Original CRISPR CTGCTGCTTCAGAAGCCATG TGG (reversed) Intronic
901914375 1:12486770-12486792 GTGCTGCTTCCGAAGCCCAGAGG - Intronic
902004960 1:13224868-13224890 CTGCTTCTTCAGAGGCCACCTGG - Intergenic
902149131 1:14428630-14428652 CTGAGGCTTCCCAAGCCATGTGG - Intergenic
902584080 1:17427347-17427369 GTGCTGCTTCAGGTGCCATGCGG - Intronic
902603795 1:17557568-17557590 CTGCTGCTTCAGAATCTCTAAGG - Intronic
903401149 1:23050427-23050449 CTGCTTCTTGAGAAGTCATCCGG - Exonic
904290970 1:29485691-29485713 CTGTTGGCTCAGAAGCCAGGAGG - Intergenic
906048693 1:42852874-42852896 CTCCTCCTTCAGAAGCCAAAAGG - Intergenic
907248313 1:53121863-53121885 CTGTGGCTTCAGAAGCCCGGGGG + Intronic
907399129 1:54213666-54213688 CTGCTGAATCAGAAACCCTGGGG + Intronic
907677027 1:56527612-56527634 AGGCTGCCCCAGAAGCCATGTGG - Intronic
908889854 1:68833940-68833962 CTGAGGCTTCTCAAGCCATGGGG - Intergenic
909169132 1:72271951-72271973 CTGAGGCTTCACCAGCCATGTGG + Intronic
910502251 1:87906059-87906081 CTTCTCCTTCAGAAGCAATATGG - Intergenic
911289644 1:96041636-96041658 CTGCGTCTTTAGATGCCATGTGG + Intergenic
917637972 1:176955495-176955517 CTCCTTCTCCAGAAGCCACGTGG + Intronic
919705524 1:200671411-200671433 CTGCGGCATCAGAGGCTATGGGG + Intergenic
921281266 1:213570453-213570475 ATGCTTCTTCAGGAACCATGAGG - Intergenic
921808044 1:219478380-219478402 CTGCTGCTGCTGAGGCCCTGGGG - Intergenic
922358011 1:224795204-224795226 CTGCTGCTTAAGGAGCCCTAGGG - Intergenic
923294280 1:232578457-232578479 CTGATGCTTCAGAGGCTTTGAGG - Intergenic
1063356322 10:5402427-5402449 CTGATGATGCAGAAGACATGGGG - Intronic
1063948679 10:11202398-11202420 CTGCAGCTTCCGAAACCATCGGG - Intronic
1064476532 10:15696105-15696127 CTTCTGCTTCAGACGACAGGCGG - Intronic
1065052366 10:21808661-21808683 CAGCTACTACAGCAGCCATGAGG + Intronic
1065629364 10:27661553-27661575 CTGCTCCTTCACCAGCCATTTGG - Intergenic
1066362024 10:34740289-34740311 CTGCTGTCTCAGAACCCAGGAGG - Intronic
1068799516 10:61123972-61123994 CTGATGCTTGAATAGCCATGAGG - Intergenic
1068892036 10:62157942-62157964 CTGCTATTTCAGAGGACATGTGG + Intergenic
1068919334 10:62465965-62465987 CTGCTGCTTCTCATCCCATGGGG - Intronic
1070601023 10:77866317-77866339 CTGCTGCATCAGAAACGCTGAGG - Intronic
1070644086 10:78189394-78189416 CTACTGAATCAGAAACCATGGGG + Intergenic
1070964481 10:80521217-80521239 CTGCTGGCTGAGAAGCCATCAGG - Exonic
1071398054 10:85242469-85242491 CTGCTGTTTCACAAGGAATGAGG - Intergenic
1073116335 10:101093940-101093962 CTGCTCCCTGAGAAGCCTTGAGG + Intronic
1073245668 10:102088351-102088373 CTGCTGCTTCATAAGCAATGGGG + Intergenic
1073418721 10:103406363-103406385 CTGCTGGTTCAGAAGCCATGGGG - Intronic
1074050930 10:109880851-109880873 CAGCTGAGTCAGAAGGCATGAGG - Exonic
1074269082 10:111935170-111935192 CTGCTGCATCACAATTCATGTGG - Intergenic
1074697753 10:116065964-116065986 CTGCTCCTTCAGGAGCCACTTGG - Intronic
1075878213 10:125825209-125825231 CTGTTCCTGCTGAAGCCATGTGG + Intronic
1075896212 10:125997281-125997303 CTGCACCTTCAGAAGCCAGCTGG - Intronic
1076630275 10:131848257-131848279 CTGATGCTGCAGCCGCCATGAGG + Intergenic
1077239830 11:1504738-1504760 CAGCTGCTGCGGAAGCCCTGGGG - Intergenic
1080640663 11:34156459-34156481 CTGATACTGCAGAAACCATGTGG + Intronic
1080923272 11:36730406-36730428 CTACTGCATCAGAAGCTTTGGGG + Intergenic
1082969317 11:59002938-59002960 CAGCTGCTCCTGAAGACATGGGG - Intronic
1083274613 11:61589589-61589611 CTGCTCCTTCTGCAGGCATGGGG - Intergenic
1083636292 11:64122708-64122730 CTGGTGCTCCAGAGGCCAAGTGG + Intronic
1084891917 11:72240839-72240861 GTGATGCTTGAGAAGCCAGGAGG - Intronic
1087278106 11:96180598-96180620 CTGCTCCATCAGAAGCCAAAGGG + Intronic
1088711083 11:112509454-112509476 CTGCTGAGGCAGAAGCCATGGGG - Intergenic
1089073225 11:115717135-115717157 CGGCTCCTTAGGAAGCCATGGGG + Intergenic
1089139891 11:116276635-116276657 CTGCGGCTTCAGAAGCAGGGCGG - Intergenic
1089989723 11:122847961-122847983 CTGCTGCTGCAGAAACCACATGG - Intronic
1090028199 11:123185461-123185483 CTGCAGCTTCCCAAGCCCTGAGG - Intronic
1091652612 12:2320976-2320998 CTGCTGCTGCAGCATCCGTGTGG - Intronic
1092761966 12:11818744-11818766 ATGCTGCTTCTCAAGCCTTGGGG + Intronic
1095923457 12:47554777-47554799 CTGTTGGGTCAGAAGGCATGTGG - Intergenic
1097315437 12:58166204-58166226 CTGAGGCCTCAGCAGCCATGTGG + Intergenic
1097728452 12:63100679-63100701 CTGCTACTTCAGAAGCATTCTGG - Intergenic
1098472866 12:70865619-70865641 CTGCTTCGTCTGAACCCATGTGG + Intronic
1100665708 12:96750273-96750295 CTGCTGCTGCAGGAGACAGGTGG - Intronic
1101119405 12:101563725-101563747 CTGCTGCTACAGAAGACAGCGGG - Intergenic
1101154984 12:101918735-101918757 ATGCAGCTTCAGAAGGCATGGGG + Intronic
1101543486 12:105686274-105686296 CTTCTGCTTCAGAAGCCAAGTGG + Intergenic
1102754585 12:115327078-115327100 CTGCTGCATCAGAAGCCGTGGGG - Intergenic
1102912791 12:116731282-116731304 CTGATGGTGCAGAAGTCATGGGG - Intronic
1104810341 12:131616741-131616763 ATGCAGGTTCAGCAGCCATGAGG - Intergenic
1105248305 13:18673001-18673023 CTGCTGAATCAGAAGCTCTGGGG + Intergenic
1105736945 13:23281400-23281422 CTGCTGAATCAGAAGCTCTGGGG - Intronic
1106927428 13:34628084-34628106 CTTCTGCTACAGAGGCAATGGGG - Intergenic
1108588713 13:51893464-51893486 CTGCTGCTTCAGAATCACTGTGG + Intergenic
1109268625 13:60229326-60229348 GTGCTGCTTCAGAGACCAGGTGG + Intergenic
1109766101 13:66900171-66900193 TTGCAGTTTCTGAAGCCATGTGG + Intronic
1109951798 13:69510024-69510046 CTGAGGCTTCCCAAGCCATGTGG + Intergenic
1111963969 13:94842003-94842025 CTGCTGCCTCTGAGGACATGGGG - Intergenic
1112384523 13:98926236-98926258 CTGGTTCTTAAAAAGCCATGTGG + Intronic
1112436036 13:99391973-99391995 CTGGAGCTTCTGAAGCCCTGGGG - Intergenic
1112807243 13:103176383-103176405 CTGCTGAATCAGAAGCTTTGAGG - Intergenic
1113599141 13:111555783-111555805 CTGATGCTTCAATTGCCATGAGG - Intergenic
1115034343 14:28839088-28839110 TTCCTGCTTGAAAAGCCATGTGG + Intergenic
1115875272 14:37854190-37854212 CTGAGGCTTCCCAAGCCATGTGG + Intronic
1117128149 14:52654502-52654524 GGGATGCTTCAGAAGTCATGAGG + Intronic
1117602811 14:57391539-57391561 CTGCAGCTTAAGAAGCCCTTCGG + Exonic
1117823787 14:59678795-59678817 CACCTGCTTCAGAAGCACTGGGG + Intronic
1118050467 14:62020857-62020879 CTGCATCCTGAGAAGCCATGTGG - Intronic
1118604466 14:67492556-67492578 CTGCACCTTCAGAAGTGATGGGG + Intronic
1119469826 14:74888903-74888925 CTGCTGAGTCAGAATCCCTGGGG + Intronic
1119709238 14:76809381-76809403 ATGCTGCTTCAGAGGACAGGTGG - Exonic
1120013871 14:79448220-79448242 CTCCTCCTTCAGAAGACATGGGG + Intronic
1120084398 14:80253245-80253267 CTGATGCCTCACCAGCCATGTGG + Intronic
1120519795 14:85513273-85513295 CTGAGGCTTCACTAGCCATGGGG - Intergenic
1121148352 14:91606219-91606241 CTACTGCATCAGAAACTATGAGG - Intronic
1121328049 14:93033291-93033313 CTGCTGCCTCAGAGTCCCTGAGG - Intronic
1121735179 14:96213424-96213446 CTCCAGCATCAGGAGCCATGTGG + Intronic
1122245857 14:100403016-100403038 CTGCTAATACAGAAGCCCTGAGG - Intronic
1122283062 14:100635649-100635671 CCGCACCTTCAGAAGCCAAGAGG - Intergenic
1123802767 15:23838716-23838738 CTGCTGGCTCAGAAAACATGTGG - Intergenic
1125079799 15:35659341-35659363 CTGCTGACTCAGAACCCATGTGG - Intergenic
1125237904 15:37537425-37537447 CAGCTGAGTCAGAATCCATGAGG - Intergenic
1125783219 15:42290387-42290409 CTGCAGCTACAGAAGATATGAGG - Intronic
1127059534 15:55168083-55168105 CTACTGCTTCAAAAGGCAAGAGG + Intergenic
1127258955 15:57313911-57313933 CTGCTGCCTCAGACTCCAAGTGG + Intergenic
1128139442 15:65287972-65287994 CTAGTGCTTCAAAAGCCATGGGG + Intronic
1128769241 15:70269416-70269438 CTTGTGTTTCAGAAGCCAAGGGG + Intergenic
1128995914 15:72294460-72294482 CTGCAGCATAAGAAGCCACGGGG + Intronic
1130556366 15:84925336-84925358 CTGCTGAATCAGAAACGATGGGG + Intronic
1131067749 15:89444723-89444745 CTGCTGCTTCAGATGGAGTGGGG - Intergenic
1131254448 15:90852798-90852820 CTGCTGAGTCAGAATCCATCTGG - Intergenic
1133689881 16:8203237-8203259 CTGTTCCTGCAGAAGCCATTAGG - Intergenic
1134370477 16:13619577-13619599 CTGAGGCTTCCCAAGCCATGTGG + Intergenic
1135037391 16:19089608-19089630 CTGCTGCAGGAGTAGCCATGTGG - Intergenic
1135296557 16:21284026-21284048 CCGCTGCTCCAGACGCCAGGGGG + Intronic
1140644883 16:77018654-77018676 TTACTGCTTCAGAAGCTGTGGGG - Intergenic
1141008472 16:80375142-80375164 CTGGTTCCTCAGAAGGCATGGGG - Intergenic
1141993503 16:87623064-87623086 CTGCTGCCTCAGAATCTGTGGGG - Intronic
1142170456 16:88619396-88619418 CAGCTGCTTCAGAAGGAAGGTGG + Intronic
1143925454 17:10365455-10365477 CTACTGAATCAGAAACCATGGGG - Intronic
1144282861 17:13744134-13744156 CAGCAGCTTCAGAAGTCATTAGG + Intergenic
1145980687 17:29009643-29009665 CTGCTGACTCCGAAGCCAGGGGG + Intronic
1147217657 17:38910272-38910294 CTGCTGCCACAGAGGCCATATGG - Intronic
1147259444 17:39200328-39200350 CTGCTGCGGCCGCAGCCATGAGG + Exonic
1147467204 17:40619539-40619561 GTGCTGCTTCACAGGCCTTGGGG + Intergenic
1147920267 17:43912027-43912049 CTGGGGCTCCAGAAGCCCTGGGG - Intergenic
1148031338 17:44623227-44623249 CTTCTGATTCAGAAGGTATGAGG + Intergenic
1148350913 17:46941474-46941496 TGGCTGCTTCAGAAGCAGTGGGG + Intronic
1149559229 17:57596302-57596324 CTGCTGCTTCAAAAGCGCTCTGG - Intronic
1150498224 17:65625575-65625597 TTCCAGCTTCAGAAGACATGGGG - Intronic
1150586135 17:66519761-66519783 TTGCTGCTTCAGAAGATCTGTGG - Intronic
1150978635 17:70117973-70117995 TAGCTGCATCAGAGGCCATGTGG - Intronic
1151757562 17:76083377-76083399 TTCCTGTTTCAGAAGCCATCAGG + Exonic
1152085436 17:78214890-78214912 CAGCTGTTTAAGAAGCAATGAGG - Intronic
1152459131 17:80432175-80432197 CACCTGCTTCAGAAGCTTTGGGG + Intronic
1152556443 17:81055426-81055448 CTGCTGCTGGGGCAGCCATGGGG - Intronic
1154440547 18:14386109-14386131 CTGCTGAATCAGAAGCTCTGGGG - Intergenic
1156465665 18:37346744-37346766 CTGCTTGTGCAGAAGCCCTGGGG + Intronic
1156766766 18:40665891-40665913 CTGATGCTTCCCCAGCCATGCGG + Intergenic
1158365623 18:56731570-56731592 CAGATGCCTCAGAAGCCAAGAGG - Exonic
1158613082 18:58961155-58961177 CTGCTGAATCAGAAGCTGTGGGG - Intronic
1158630810 18:59112399-59112421 AGGCTGCTTCTGCAGCCATGTGG + Intergenic
1158726151 18:59974546-59974568 CTGCCGTTTCAGAATCCAGGAGG - Intergenic
1158907986 18:62032374-62032396 CTTCTGCTTCACATGCCATCTGG + Intergenic
1158926569 18:62270139-62270161 CTGCTGCTTCAGAAGCCATGTGG - Intronic
1159476095 18:68922643-68922665 CTGAGGCTTCAGAAGGCATGGGG - Intronic
1159811630 18:73024344-73024366 CTTCTGCTTCAGAATTCATGAGG - Intergenic
1161302589 19:3550028-3550050 CTGCTGCTTCTGAGGCCAGCAGG - Intronic
1161629620 19:5346282-5346304 CTGCTTCTTCAGGAGCGTTGTGG + Intergenic
1162795290 19:13084006-13084028 CTGCTGCATCAGATGCTCTGGGG - Intronic
1163644037 19:18478297-18478319 CTGCTGCCTTAGAAGCTTTGGGG + Intronic
1165833016 19:38738451-38738473 CTGCGGCTGCGGAACCCATGGGG - Exonic
1166071344 19:40389970-40389992 CTGCTGTGTCAGCAGCCAGGCGG - Exonic
1166587810 19:43966719-43966741 CTGATGGTTCAAAAGACATGAGG - Exonic
1166590820 19:43997008-43997030 CTGATGGTTCAAAAGGCATGAGG - Exonic
1168268681 19:55237823-55237845 CTTCTGCTACAGGAGCTATGCGG + Intronic
1168562995 19:57398781-57398803 CTGGTGCTGGAGAAGGCATGAGG - Exonic
925390000 2:3488124-3488146 CTGCTGCTGCAGTAGCTGTGTGG - Intergenic
925840818 2:7990168-7990190 TTGCAGCTTCAGAAGCCAGGAGG + Intergenic
926139406 2:10359462-10359484 CTGCTGTCACAGAGGCCATGAGG - Intronic
926798212 2:16636340-16636362 CTGGTGCTTGAGAAGCCACTGGG - Intronic
931052367 2:58428676-58428698 CTGCTGCTGCTGCAGCCAGGGGG + Intergenic
931660100 2:64552496-64552518 CTGATAATTCAGAAGCCATTAGG + Exonic
931711786 2:64994066-64994088 CTTCTCCTCCAGATGCCATGTGG - Intronic
933767882 2:85722905-85722927 GCCCTGCCTCAGAAGCCATGAGG - Intergenic
934886824 2:98032318-98032340 CTGCTGCCTCTGAAGCCTGGAGG + Intergenic
935008582 2:99107800-99107822 CTTCTGCTTTGCAAGCCATGTGG - Intronic
935584411 2:104787841-104787863 CTGCTGATTCAGCAGGCCTGGGG - Intergenic
936396242 2:112133890-112133912 CTGCTGCTTCCAAAGGCATGTGG + Intergenic
936624520 2:114134195-114134217 CAGCTGCTTGAGAAGCCATAGGG - Intergenic
937136854 2:119560624-119560646 CTTCAGCTTGAGAAGCCATTAGG + Intronic
937330955 2:121029306-121029328 CTGCTGCTTCAAATGCCAGAAGG - Intergenic
939683048 2:145162307-145162329 CTGCTGCTTATGAAGTGATGTGG - Intergenic
941811074 2:169756632-169756654 CTGCTGCTCCAGAGGGCACGAGG + Intronic
943759303 2:191591240-191591262 CTACTGCGTCAGAAACCCTGGGG + Intergenic
946378679 2:219330108-219330130 CTACTGCATCAGAAGCCCTAGGG - Intronic
946542206 2:220697061-220697083 ATGCAGCTTCAGAAGGCTTGAGG - Intergenic
947582742 2:231331773-231331795 CTCCTGTTTCAGGAGACATGGGG - Exonic
948254434 2:236555866-236555888 TTGCTTCTACAGAAGCCCTGTGG - Intergenic
948292522 2:236836599-236836621 CTGAGGCCTCTGAAGCCATGTGG - Intergenic
948359003 2:237405150-237405172 CTGATGATTCAGAACCCATATGG + Intronic
948546209 2:238730553-238730575 CTACTGCATCAGAAACCCTGGGG + Intergenic
1168796497 20:613225-613247 AGGCTGCCTCAGAAGCCATGTGG - Intergenic
1169982775 20:11405284-11405306 CTGCTGAATCAGAATCCCTGTGG + Intergenic
1170284578 20:14692174-14692196 CTACTGATTCAGAAACCCTGTGG + Intronic
1170706593 20:18749443-18749465 AGCCTGCTGCAGAAGCCATGAGG + Intronic
1171487068 20:25493006-25493028 CTGCAGCCTCAGAACCCACGTGG - Intronic
1172938331 20:38637103-38637125 CTGCTGCTCCAGAAGGCACCAGG - Intronic
1173108146 20:40157883-40157905 CTGCTGCTTCAAAACCTTTGAGG + Intergenic
1173954206 20:47018186-47018208 CTGTGGCCTCAGAAGCCCTGAGG - Intronic
1174147521 20:48462542-48462564 CTTTACCTTCAGAAGCCATGGGG + Intergenic
1174556916 20:51402316-51402338 TTGCTACTTTAGAAGCCGTGTGG - Intronic
1175174091 20:57100004-57100026 CTGGTGCTCCAGTAGCCATTTGG + Intergenic
1175321805 20:58093403-58093425 CTGCTGGATCAGAAGCTCTGGGG - Intergenic
1175368834 20:58472955-58472977 CTGCTTCTTCAGAAGACACTGGG + Intronic
1176455496 21:6905058-6905080 CTGCTGAATCAGAAGCTCTGGGG + Intergenic
1176833668 21:13770106-13770128 CTGCTGAATCAGAAGCTCTGGGG + Intergenic
1177227239 21:18272994-18273016 CTGCTGAATCAGAAACTATGAGG - Intronic
1178724062 21:35035762-35035784 CTCCAGATTCAGAACCCATGTGG + Intronic
1178869066 21:36357060-36357082 ATTCTGCTTAAGTAGCCATGTGG + Intronic
1179288327 21:39996952-39996974 CTCCTCCTGCAGAAGCCAAGGGG + Intergenic
1180995319 22:19962593-19962615 CTGCTGCTTCTGAGGCACTGGGG + Exonic
1181629015 22:24140755-24140777 CTCCTGCTTCTGAGGCCGTGTGG + Intronic
1181822979 22:25490139-25490161 CTGGTGCTGCAGCAGCCATCAGG + Intergenic
1183898905 22:40990633-40990655 CTCCTGCTTCGGAAGCCACCAGG - Intergenic
1184405483 22:44298384-44298406 CTTCTGATTCAGAAGCCCAGTGG - Intronic
1184735681 22:46396558-46396580 CTGCACCTTCAGAGTCCATGTGG - Intronic
1184887657 22:47356249-47356271 CTGCAGGTCCAGGAGCCATGGGG - Intergenic
1185275132 22:49947476-49947498 CTGGTGCACCAGAAGCCACGAGG - Intergenic
950440242 3:13006299-13006321 GTGCAGCCTCAGATGCCATGTGG + Intronic
950551267 3:13667522-13667544 CATATGCTTCAGAAGCAATGAGG - Intergenic
951436386 3:22670107-22670129 TTGTTGCTTCAGGAGCCTTGAGG + Intergenic
954092761 3:48298361-48298383 CTACTGCTTCAGGTGCCATTGGG - Intronic
954412395 3:50376504-50376526 CTGCTGCTTCTGTACCCCTGTGG + Intronic
954514711 3:51162741-51162763 CTGTTGCTTTAGAAGCAATTAGG - Intronic
955870455 3:63432948-63432970 CTCCTGAATCAGAAGCCAGGAGG - Intronic
957314547 3:78560533-78560555 CTGCTTCTTAACAAGTCATGAGG + Intergenic
959022316 3:101201392-101201414 CTGCTGCATCAGAAGCTAGGGGG - Intergenic
959507280 3:107170356-107170378 CTGAGGCCTCACAAGCCATGTGG + Intergenic
961053617 3:123767975-123767997 GGGCTCCTTCAGAAGCCAAGTGG - Intronic
961636358 3:128335440-128335462 CTGCAGGTGCAGAGGCCATGAGG + Intronic
962767528 3:138579460-138579482 CTTCTGCTTGAGAAGACAAGAGG + Intronic
963203515 3:142608836-142608858 CTGCATTTTCAGAAGACATGTGG - Intronic
963480943 3:145873954-145873976 CTAATGCTTCTGAAGCCATTTGG - Intergenic
963975069 3:151471219-151471241 CTTCTGCTTCCCCAGCCATGTGG + Intergenic
964182939 3:153909433-153909455 CTGCTTCTTCAGAAGACAAGAGG + Intergenic
964476412 3:157101644-157101666 ATGCTGTTGCAGATGCCATGAGG - Intergenic
964821221 3:160772126-160772148 CTGCTGCTGAAGAAGTCATGGGG + Intronic
965736889 3:171830087-171830109 CAGCAGCTGCAGAAGGCATGGGG + Intergenic
967414052 3:189197147-189197169 CTGCTGATTCAGAAGCTTGGTGG - Intronic
969661868 4:8534980-8535002 CTGAGGCTTCCCAAGCCATGTGG - Intergenic
970345373 4:15147729-15147751 CTGCTGATAGAGAAGTCATGGGG + Intergenic
973020456 4:45199249-45199271 CTAACGCTTCAGAAACCATGAGG - Intergenic
973060636 4:45719306-45719328 CTGCTGCTTCAGAAAGGAAGGGG + Intergenic
973078464 4:45961078-45961100 CTGAGGCTTCCCAAGCCATGTGG - Intergenic
975992474 4:80271525-80271547 CTCCTGCTTGAGAAGGCACGGGG - Intronic
976811939 4:89107941-89107963 CTGAGGCTTCACCAGCCATGTGG + Intronic
979445869 4:120810360-120810382 GTTCTGCTTCAGAAGCCATAAGG + Intronic
979787372 4:124733064-124733086 CTGAGGCTTCCCAAGCCATGGGG + Intergenic
981466216 4:145075739-145075761 CTGCTGGTTCAGATGCCTGGGGG - Intronic
983023227 4:162705586-162705608 CCCCTGCTTCAGCTGCCATGGGG - Intergenic
984699661 4:182810659-182810681 CTGAGGCCTCTGAAGCCATGTGG - Intergenic
984855132 4:184188603-184188625 AAGCTGGTTCAGAAGCCACGTGG + Intronic
986651017 5:9963545-9963567 CTGCTGCTCCAGAAGTCTTAGGG - Intergenic
989225684 5:39025548-39025570 CTGTTGCTTAATAAGCCATTCGG - Intronic
989743609 5:44801101-44801123 CCCCTGCTTCAAAAGACATGAGG + Intergenic
990981271 5:61604514-61604536 CTGCTGAATCAGAATCCCTGGGG + Intergenic
991008456 5:61855755-61855777 ATGCTGCTTCATAATCCAGGGGG - Intergenic
991535790 5:67668219-67668241 CTGATGCTTCCCCAGCCATGTGG + Intergenic
994145780 5:96393468-96393490 CTGCCGCTTGAGAGGCAATGAGG + Intronic
997488332 5:134250817-134250839 CAGCTGCTTCAGAAGACTTATGG + Intergenic
997916691 5:137933867-137933889 CTGCTGGTTCTGTAGGCATGAGG + Intronic
998129481 5:139644157-139644179 CTGCTCCTTCAGACGTCATGGGG + Intergenic
998377703 5:141702292-141702314 CTGCCGCTTGAGATGCCATCAGG + Intergenic
999372368 5:151063833-151063855 CTGGAGCCTCAGAAGCCAGGCGG - Intronic
999582187 5:153051145-153051167 CTGCAGCTTAACTAGCCATGTGG - Intergenic
999878334 5:155833478-155833500 CTGCTACTCCACAAGCTATGAGG + Intergenic
999970906 5:156861397-156861419 ATTCTGATTCAGAAGCCCTGAGG - Intergenic
1000020980 5:157319235-157319257 CTTCTCCTGCAGAAGTCATGGGG - Intronic
1001397867 5:171429602-171429624 CTGCTGCTGGAGGAGCCAGGTGG + Intronic
1002896529 6:1383237-1383259 CTGCTCCTCCAGAAGCCAGTCGG - Intergenic
1003056418 6:2824841-2824863 AAGATGCTTCAGCAGCCATGAGG + Intergenic
1004318034 6:14608614-14608636 CTGCTGATGCAAAAGCAATGGGG - Intergenic
1005953109 6:30645925-30645947 CTGCTGCTACAGCCGCCATGGGG + Exonic
1006415424 6:33900871-33900893 CTGTTGCTGCAGATGCCACGAGG + Intergenic
1006719425 6:36140524-36140546 CTGCTGAGTCACAAGCCCTGGGG - Intronic
1008031797 6:46704836-46704858 CAGCTGCTAAAGCAGCCATGAGG - Intronic
1009353440 6:62709635-62709657 CTGCTGCTTGAAAAGCCCTTGGG - Intergenic
1010713173 6:79198815-79198837 TTGCTGCACCAGAATCCATGGGG + Intergenic
1010897838 6:81387401-81387423 CTGCTGCTTCAAAAAGTATGGGG + Intergenic
1012146249 6:95686773-95686795 CTGCTGCTTCCTCAGCCTTGGGG - Intergenic
1012507026 6:99958971-99958993 CTGCTGCTCCAGAGGACCTGTGG + Intronic
1012643349 6:101650314-101650336 CTGGTGCTTCAGAAACCAAGTGG - Intronic
1012945956 6:105465977-105465999 CTTCTGCTTCACAAGGCGTGAGG + Intergenic
1015312726 6:131782958-131782980 CTGAAGCTTCAGAAGCCAGGTGG + Intergenic
1015757578 6:136623222-136623244 TTGCTTCTCCAAAAGCCATGTGG + Intronic
1016871568 6:148822614-148822636 CTACAGCCTCAGTAGCCATGAGG + Intronic
1017676567 6:156820311-156820333 CTGCTGTTTAAGTGGCCATGTGG + Intronic
1017785833 6:157756664-157756686 TTGCTGCATTAGAAGCTATGGGG - Intronic
1017787395 6:157767966-157767988 CTGCTGCCTCACAGGCCATCAGG + Intronic
1018030164 6:159835433-159835455 GTGCTGCCTGAGAAGCCAAGAGG + Intergenic
1018832039 6:167450786-167450808 CTGCTTCTTCAGAGGGCATGGGG - Intergenic
1019863407 7:3682254-3682276 CTGCTGTTTAGTAAGCCATGGGG - Intronic
1019961795 7:4466675-4466697 CTGCTGAATCAGAAACCCTGAGG + Intergenic
1020482621 7:8680842-8680864 CAGCTCCTGCATAAGCCATGAGG + Intronic
1020571841 7:9872972-9872994 AAGCTTCTTCAGAAGTCATGAGG - Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1024857267 7:53796250-53796272 CTGCTGCCTCAGAAACTCTGGGG - Intergenic
1026291219 7:69007859-69007881 GTGCTGCTTCAAAAGGCATCAGG + Intergenic
1028319719 7:89444035-89444057 CTGATTCTTCAAAAGCAATGAGG - Intergenic
1030303404 7:107996910-107996932 CTGCTGTTTCAGAAGTCCTCGGG + Intronic
1030411114 7:109181819-109181841 CTGCAGCCTCAGCAGCCATGCGG - Intergenic
1031090633 7:117349542-117349564 CTGCTGCTTCAGATGAGATATGG - Intergenic
1031113937 7:117646645-117646667 CTGCTGCTGCTGATGGCATGGGG + Intronic
1033369598 7:140696501-140696523 AAGCTGTTTCAGAAGGCATGGGG + Intronic
1033472938 7:141665413-141665435 CTGGTGCTTCAGGATCCAGGTGG + Intronic
1034648395 7:152669333-152669355 CTGCTGCTGCTGAAGACATTTGG - Intronic
1035448547 7:158959220-158959242 CTGCTCCTGCAATAGCCATGTGG + Intergenic
1035734851 8:1880851-1880873 CGGCTGCTCCAGAAGCTGTGTGG - Intronic
1035738526 8:1907524-1907546 CTGCTGCTCCAGAACCCCTCAGG + Intronic
1036182252 8:6595559-6595581 CTTCTGCTCCAGAAGAGATGCGG + Intronic
1036730172 8:11256003-11256025 CTGCTGTGGCCGAAGCCATGAGG + Intergenic
1037073755 8:14686852-14686874 GTGCTGCTGATGAAGCCATGTGG - Intronic
1037820857 8:22133890-22133912 CTGCTGCTGGAGAAGTCCTGGGG - Intergenic
1038427397 8:27472850-27472872 CTGCTGCTTCTTAATCCATGAGG - Intronic
1038854036 8:31311940-31311962 GTGCTGCTTCAGAAACTATTTGG + Intergenic
1039566492 8:38555765-38555787 CCCCTGTGTCAGAAGCCATGTGG + Intergenic
1039969472 8:42308902-42308924 CTGCTGCTCCAGTAGCTCTGGGG - Exonic
1039992115 8:42497397-42497419 CTGCTGAATCAGAAAACATGGGG - Intronic
1040370663 8:46769646-46769668 CTTCTGTTTCAAAAGTCATGGGG + Intergenic
1040978647 8:53221943-53221965 TTGCTGATTCACAAGTCATGGGG - Intergenic
1042802230 8:72732036-72732058 CTCCTCCTTCAGATGCCAAGAGG + Intronic
1044214450 8:89592180-89592202 CTGCCTCTTCAGAAGTCTTGTGG - Intergenic
1044393261 8:91678579-91678601 CTGCTGCTAGAGAAGCCCTTTGG + Intergenic
1044596032 8:93959456-93959478 CTGGAGCTTCAGTAGCCACGAGG - Intergenic
1044655518 8:94544303-94544325 GTGCTGCTGCAGAAGCCACTGGG - Intronic
1045345687 8:101291605-101291627 GTGGTTTTTCAGAAGCCATGTGG - Intergenic
1047872406 8:129098470-129098492 CTGCTGCTGCACAAGTCACGGGG + Intergenic
1050108414 9:2189678-2189700 CTGCTGCTTGACAAGCTATAAGG - Intronic
1050652938 9:7792544-7792566 CTACTGAATCAGAAGCCCTGGGG - Intergenic
1055004016 9:71484851-71484873 CTACTGAATCAGAAGCCGTGGGG - Intergenic
1055106803 9:72521792-72521814 CTACTGCCTCAGAAACTATGAGG + Exonic
1056504395 9:87243773-87243795 TTGCTGCGTCATAAGACATGTGG - Intergenic
1056938922 9:90938469-90938491 TTGCTGCTTCAGAAGCTCTAGGG - Intergenic
1059354167 9:113686828-113686850 CTGCGGCTTCACAAGGCTTGGGG - Intergenic
1061649018 9:132031152-132031174 CTGCTCCATCAGAAGCCAGGTGG + Intronic
1061725186 9:132578718-132578740 CTGCTTGTTCAGAAGCCACCTGG - Intergenic
1187131986 X:16512069-16512091 CTTCGGCTTCAGTAGACATGAGG + Intergenic
1187785454 X:22880353-22880375 CTACTGTATCAGAAGCCCTGTGG - Intergenic
1188863291 X:35284695-35284717 CTGAGGCCTCACAAGCCATGTGG - Intergenic
1189440687 X:41032898-41032920 CTACTGAATCAGAAGCCTTGGGG - Intergenic
1189744158 X:44153062-44153084 TTGCTGACTCATAAGCCATGAGG - Intronic
1191589313 X:62863439-62863461 CTACTGTTTCAGAAGCCACAGGG - Intergenic
1192589252 X:72346355-72346377 TTTCTTCTTGAGAAGCCATGAGG - Intronic
1193442879 X:81565014-81565036 CTGCTGCATCATAGGCCCTGAGG + Intergenic
1193886986 X:86994488-86994510 CTGCTGTGGCAGTAGCCATGGGG + Intergenic
1194916792 X:99717692-99717714 CTGGTGCTTGGGAAGTCATGGGG - Intergenic
1194960568 X:100230601-100230623 CTGCTACTAGAGAAGCCAAGAGG + Intergenic
1197587228 X:128363720-128363742 CTGAGGCTTCTCAAGCCATGTGG - Intergenic
1198016843 X:132620195-132620217 CTCCTGCTCCAGAAGCTCTGTGG - Intergenic
1198629102 X:138615788-138615810 CTGAGGCCTCCGAAGCCATGCGG - Intergenic
1200077708 X:153559825-153559847 CTGCTGCTGCGGAAGCCGTACGG + Exonic
1201927814 Y:19308576-19308598 CTGCTTATTCAGAGCCCATGGGG + Intergenic
1202296487 Y:23363729-23363751 CAGCTGCAACAGAAACCATGTGG - Intergenic
1202574320 Y:26306868-26306890 CAGCTGCAACAGAAACCATGTGG + Intergenic