ID: 1158931734

View in Genome Browser
Species Human (GRCh38)
Location 18:62329768-62329790
Sequence CCTGCCTGGGGAGCGCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158931734_1158931740 -6 Left 1158931734 18:62329768-62329790 CCTGGCAGCGCTCCCCAGGCAGG No data
Right 1158931740 18:62329785-62329807 GGCAGGCTGCCTGTCTGCCTGGG No data
1158931734_1158931744 19 Left 1158931734 18:62329768-62329790 CCTGGCAGCGCTCCCCAGGCAGG No data
Right 1158931744 18:62329810-62329832 ACCAGAAGCTCCTTGTCAGAGGG No data
1158931734_1158931739 -7 Left 1158931734 18:62329768-62329790 CCTGGCAGCGCTCCCCAGGCAGG No data
Right 1158931739 18:62329784-62329806 AGGCAGGCTGCCTGTCTGCCTGG No data
1158931734_1158931746 27 Left 1158931734 18:62329768-62329790 CCTGGCAGCGCTCCCCAGGCAGG No data
Right 1158931746 18:62329818-62329840 CTCCTTGTCAGAGGGCTGACTGG No data
1158931734_1158931743 18 Left 1158931734 18:62329768-62329790 CCTGGCAGCGCTCCCCAGGCAGG No data
Right 1158931743 18:62329809-62329831 CACCAGAAGCTCCTTGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158931734 Original CRISPR CCTGCCTGGGGAGCGCTGCC AGG (reversed) Intronic