ID: 1158931761

View in Genome Browser
Species Human (GRCh38)
Location 18:62329984-62330006
Sequence ACTCAAAGGCTGAAAGTCGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 242}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158931761_1158931765 -1 Left 1158931761 18:62329984-62330006 CCGTCGACTTTCAGCCTTTGAGT 0: 1
1: 0
2: 0
3: 14
4: 242
Right 1158931765 18:62330006-62330028 TGCTTTGGGTCACTGCTTGCAGG 0: 1
1: 1
2: 0
3: 20
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158931761 Original CRISPR ACTCAAAGGCTGAAAGTCGA CGG (reversed) Intronic
901920863 1:12536564-12536586 ACCCCAAGGCAGAAAGTCAAGGG + Intergenic
905467526 1:38166638-38166660 CCTCAAAGGCTGAGAGTCACAGG + Intergenic
909696153 1:78470171-78470193 AAGCAAAGGCTGAAAGTCAGGGG + Intronic
912040267 1:105381531-105381553 ACTCACAGGCTCAAAGTAAATGG - Intergenic
912639191 1:111328716-111328738 ACTCATAGGCTGAAAATAGAGGG - Intergenic
912885504 1:113468084-113468106 ACACAAAGACAGAAAGTGGAAGG - Intronic
916164672 1:161955366-161955388 ACTCAAAGTCTTAAAGTAAAGGG + Intronic
917272262 1:173290362-173290384 GCTCATAGGCTTAAAGTCAAGGG + Intergenic
918552651 1:185761197-185761219 ACTCAAAGGCAAAAAGGAGATGG + Intronic
918619966 1:186591881-186591903 ACTCATAGGCTCAAAGTAAAGGG + Intergenic
919374254 1:196772874-196772896 ACTCATAGTCTGAAAGTAAAAGG - Intergenic
919651925 1:200158580-200158602 ACTCAAAGGCTAAAACAGGAAGG + Intronic
921166637 1:212512870-212512892 ACTCAAAGGCAGAGAGAAGAGGG + Intergenic
1064887889 10:20132696-20132718 ACTCATATGCTGAAAGTGAAAGG - Intronic
1065054446 10:21829655-21829677 ACTGAAAGGTTGAAAGTAAAGGG - Intronic
1066522182 10:36233275-36233297 ACTCAAAGGTGAAAAGTTGAAGG + Intergenic
1066750912 10:38655987-38656009 ACACAAAGGTTGAAAGTGAAAGG + Intergenic
1066966132 10:42267126-42267148 ACACAAAGGTTGAAAGTGAAAGG - Intergenic
1067405351 10:46018113-46018135 ACTCAAAGGATGACAGACTAAGG + Intronic
1068187310 10:53602259-53602281 ACACATAGGCTGAAAGTGAAGGG - Intergenic
1068328138 10:55522681-55522703 ACACATAGGCTGAAAGTGAAGGG - Intronic
1069059541 10:63881088-63881110 ACACAGAGGCTGAAAGTGAAGGG - Intergenic
1069464222 10:68623943-68623965 AATCCAAGGCTGAAATTCAAAGG - Intronic
1072063762 10:91844513-91844535 TCTCAGAGGCTGCAAGTCAAAGG - Intronic
1072833838 10:98690141-98690163 AGTCAAAGGCTGGAAATTGAGGG - Intronic
1073864439 10:107785987-107786009 ACTCATAGGCTGAAAGTGAGAGG - Intergenic
1078694554 11:13618272-13618294 ACCCATAGGCTGAAAGTGAAGGG - Intergenic
1078727816 11:13947537-13947559 ACTCAAAAGCTGAAAGATGCAGG + Intergenic
1079446544 11:20561894-20561916 ACTCAAAGGGTGAGGGTGGAAGG + Intergenic
1079845763 11:25465477-25465499 ACACAAATGCTGAAAGTGAAAGG + Intergenic
1079875451 11:25850950-25850972 ACACATAGGCTGAAAGTTAAGGG + Intergenic
1084772510 11:71352916-71352938 ACTCAAAGGATCAAAGGTGAAGG + Intergenic
1086423451 11:86660584-86660606 GCTCAAAGGCTAAAAATCGAGGG - Intronic
1087754516 11:102040781-102040803 ACAGAAAGGCTGAAAGTTAAAGG + Intergenic
1088703612 11:112438900-112438922 ACACACAGGCTGAAAGTGAAAGG - Intergenic
1092510058 12:9145036-9145058 ACACATAGGCTGAAAGTGAAGGG - Intergenic
1093243153 12:16702340-16702362 ACGCAAGGGCTTAAAGTGGATGG + Intergenic
1095259275 12:40080258-40080280 ACTCATAGGCTCAAAGTAAAGGG - Intronic
1097764304 12:63506843-63506865 ACACATAGGCTGAAAGTGAATGG + Intergenic
1098413938 12:70212285-70212307 ACACATAGGCTGAAAGTGAAGGG - Intergenic
1098840130 12:75467870-75467892 ACTCACAGGCTCAAAGTAAAGGG + Intergenic
1100047501 12:90400437-90400459 ACACATAGGCTAAAAGTCAAAGG + Intergenic
1101275242 12:103192523-103192545 ACACATAGGCTGAAAGTGAAGGG + Intergenic
1101652373 12:106689205-106689227 ACTTAAAAACTGAAAGTCCAAGG + Intronic
1107261164 13:38493402-38493424 ACTAAAAGACTGAGAGTCAAAGG - Intergenic
1107655273 13:42586741-42586763 ACTCAAAGGCTTATACTCCAGGG - Intronic
1109664461 13:65513933-65513955 ACATAAAGGCTGAAAGTAAAAGG + Intergenic
1110747670 13:79073947-79073969 ACACATAGGCTGAAAGTGAAGGG + Intergenic
1111606009 13:90539876-90539898 ACCCAAAGGCTCAAAGTAAAGGG + Intergenic
1111777030 13:92677506-92677528 ACTCACTGGCTGTAAGTCCATGG - Intronic
1111992690 13:95132870-95132892 ACTCAGAGACAGAAAGTAGAAGG + Intronic
1112579380 13:100665191-100665213 ATTCAAAAGATGAAAGTAGATGG + Intronic
1113873247 13:113577532-113577554 ACTCATAGGTTGAAAGTGAAAGG + Intergenic
1116493321 14:45531979-45532001 ACACATGGGCTGAAAGTGGAAGG - Intergenic
1116591596 14:46782800-46782822 ACTCAGAGGCTCAAAGTAAAGGG + Intergenic
1118626963 14:67668424-67668446 ATTCAAAGGCAGAAAGTGAATGG + Intronic
1122848193 14:104512293-104512315 GCTCAGAGGCTGGAAGTTGAGGG + Intronic
1123508904 15:20975361-20975383 GCCCAAAGGCTGAAAGTGAAGGG - Intergenic
1123566126 15:21549110-21549132 GCCCAAAGGCTGAAAGTGAAGGG - Intergenic
1123602386 15:21986397-21986419 GCCCAAAGGCTGAAAGTGAAGGG - Intergenic
1124972221 15:34499172-34499194 ACTCATTGGCTGTAAGTCCATGG - Intergenic
1126278199 15:46909818-46909840 ACTCATAGGCTCAAAGTAAACGG + Intergenic
1126442838 15:48710405-48710427 ACAGAAAGGTTGAAAGTAGAAGG + Intergenic
1127325540 15:57891530-57891552 ACTCAAAGGCTGAGGGCTGATGG - Intergenic
1127408551 15:58680632-58680654 ACATAAAGGGTGAAAGTAGAGGG + Intronic
1131321542 15:91397948-91397970 ACACAAAGGCTGAAAGTAAAGGG - Intergenic
1131903899 15:97119647-97119669 ACACATAGGCTGACAGTCAAGGG + Intergenic
1202974493 15_KI270727v1_random:276200-276222 GCCCAAAGGCTGAAAGTGAAGGG - Intergenic
1132992437 16:2803002-2803024 ACACACAGGCTGAAAGTGAAAGG - Intergenic
1133901297 16:9977576-9977598 ACTCCAAAGCTGAGAGTGGAAGG + Intronic
1136731812 16:32421122-32421144 ACACAAAGGTTGAAAGTGAAAGG - Intergenic
1137257502 16:46789032-46789054 ACACAAAGGCTGAAAGTGAAGGG + Intronic
1137703392 16:50515762-50515784 ACACATAGGCTGAAAGTGAAAGG - Intergenic
1138827683 16:60340595-60340617 ACTCAAAGGCTGAGATACCAAGG + Intergenic
1138883665 16:61048907-61048929 ACACATAGGCTCAAAGTCAAGGG - Intergenic
1138905753 16:61330177-61330199 ACTTACAGGCTGAAAGTGAATGG - Intergenic
1139160724 16:64505566-64505588 ACATAAAGGCTGAAAGTAAAGGG - Intergenic
1140158300 16:72456735-72456757 ACACATGGGCTGAAAGTCAAGGG - Intergenic
1141348111 16:83267222-83267244 ACACAAAGGCTGAAGGTGCAGGG + Intronic
1202994578 16_KI270728v1_random:96132-96154 ACACAAAGGTTGAAAGTGAAAGG + Intergenic
1203021265 16_KI270728v1_random:408474-408496 ACACAAAGGTTGAAAGTGAAAGG + Intergenic
1142744380 17:1948389-1948411 ACTCCAGGGCTGAAGGCCGAGGG + Intronic
1145835713 17:27952871-27952893 ACTCAATGTCTGAAAGGCCAAGG - Intergenic
1146576636 17:33999226-33999248 ACACATAGGCTGAAATTCAAGGG - Intronic
1148854627 17:50572021-50572043 ACTCACAGGCTGAAATTCTCAGG - Exonic
1150000664 17:61436457-61436479 ACACACAGGCTGAAAGTAAAGGG - Intergenic
1150031845 17:61746465-61746487 ACCCATAGGCTGAAAGTGAAGGG + Intronic
1152027455 17:77821113-77821135 ACAGAAATGCTGAAAGTCAAAGG + Intergenic
1156140802 18:34108472-34108494 ACACATAGGCTGAAAGTGAAAGG + Intronic
1156931149 18:42645154-42645176 ACTCAAAGGCAGATAGGAGAGGG - Intergenic
1157145462 18:45158069-45158091 ACTCAAAGTCTGAAAGGGGGAGG - Intergenic
1157531216 18:48422532-48422554 ACTCATAGACAGAAAGTCGCAGG + Intergenic
1158789159 18:60754762-60754784 ACTCAAAGGCAGACAGAAGAGGG - Intergenic
1158931761 18:62329984-62330006 ACTCAAAGGCTGAAAGTCGACGG - Intronic
1159033489 18:63255078-63255100 AATCAAAGGATGAAAGACAACGG + Intronic
1161760845 19:6171084-6171106 ACTCAGAGGCTCAAAGTAAAGGG - Intronic
925790486 2:7480845-7480867 ACATATAGACTGAAAGTCGAGGG + Intergenic
928475972 2:31628338-31628360 ACCCATAGGCTCAAAGTAGAGGG - Intergenic
928477059 2:31638779-31638801 ACACATAGGCTGAAAGTAAAAGG - Intergenic
928491822 2:31792340-31792362 ACTCAGAAGCAGAAAGTCAATGG + Intergenic
928799504 2:35069773-35069795 ACCCACAGGCTGAAAGTAAAGGG + Intergenic
931818438 2:65928056-65928078 ACACAAAGGCTCAAAGTAAAAGG - Intergenic
931864358 2:66393256-66393278 ACACATAGGCTCAAAGTAGAAGG + Intergenic
932843200 2:75104188-75104210 ACACAAAGACTGAAAGTGAAGGG + Intronic
933749219 2:85592427-85592449 ACACTAGGGCTGAAAGTCAAGGG + Intronic
934313908 2:91898143-91898165 ACACAAAGGTTGAAAGTGAAAGG + Intergenic
935452035 2:103221081-103221103 ACTCACAAGCTGAAATTCCAAGG + Intergenic
936731978 2:115393497-115393519 ATTCAAAGGCTAAAAGACCATGG - Intronic
938726574 2:134113999-134114021 ATTCAAAGGCAGCAAGTCCAGGG + Intergenic
938952767 2:136270861-136270883 ATACATAGGCTGAAAGTGGAGGG + Intergenic
944269186 2:197761728-197761750 ACACATAGGCTGAAAGTGAAGGG + Intronic
947738344 2:232471512-232471534 ACTCATAGACTGAAAGTGAAAGG - Intergenic
948187215 2:236030847-236030869 AGGCAAGGGCTGAAAGTAGAAGG + Intronic
948235902 2:236390332-236390354 ACACATAGGCTGAAAGTGAAGGG - Intronic
1169809253 20:9592823-9592845 GGTCAAAGACTGAAAGTCTAAGG + Intronic
1172486808 20:35303491-35303513 ACCCCATGGCTGAAAGCCGAGGG + Exonic
1174095741 20:48088173-48088195 ACTCAAATGCTGAGAGTAGTGGG + Intergenic
1174188229 20:48722031-48722053 ACTCAAATGCAGAAACTCAACGG + Intronic
1174603037 20:51739978-51740000 ACTCTGAGACTGAAAGTCCAGGG - Intronic
1177474167 21:21597099-21597121 ACTCATAGGCTCAAAGTAAAGGG - Intergenic
1177566062 21:22821875-22821897 ACACATAGGCTGAAAGTGAAGGG + Intergenic
1180076279 21:45464779-45464801 ACACAAAGCCTTAAAATCGAAGG - Intronic
1182398883 22:30059077-30059099 ACACAAAGGCTGAAAATGAAAGG + Intergenic
1184811498 22:46836755-46836777 ACACATAGGCTGAAAGTGAAGGG + Intronic
949452601 3:4203449-4203471 ACACAAAGGCTGAAAATAAAGGG - Intronic
949703088 3:6781602-6781624 ACTCAAAATCTGAAAGGCCAAGG + Intronic
949781165 3:7690229-7690251 ACTTAAAGGCACAAAGACGAAGG - Intronic
950306802 3:11921564-11921586 ACTAAAAGACTGAGATTCGAGGG - Intergenic
950441948 3:13015572-13015594 ACTCACAGTCTCAAAGTGGAGGG + Intronic
950718807 3:14868068-14868090 ACACAAAGGCTGTAGGTGGAAGG + Intronic
950830113 3:15865147-15865169 ACCCAGAGGCTGGAAGTAGAAGG + Intergenic
950848718 3:16041701-16041723 ACTCATAGGCTCAAAGTAAAGGG - Intergenic
951180889 3:19657086-19657108 ACTCATAGACTCAAAGTCAAGGG + Intergenic
951758701 3:26120533-26120555 ACCCACAGGCTCAAAGTAGAGGG + Intergenic
952804115 3:37330610-37330632 ACTCAAAGCCTGAAGCTTGAAGG - Intronic
952874381 3:37931039-37931061 ACACATAGGCTGAAAGTGAAAGG - Intronic
952899535 3:38100293-38100315 ACTCGAAGGCTCAATGTCGAAGG - Exonic
953224673 3:41007464-41007486 ACACATAGGCTGAAAGTGAAGGG - Intergenic
958799364 3:98737762-98737784 ATCCAAAGGCTGAAAGTAAAGGG + Intronic
958842224 3:99220517-99220539 ACACAAAGGCGGAAAATAGATGG + Intergenic
959825368 3:110788727-110788749 ACTCATAGGCTGAAAGCAAAGGG - Intergenic
960012011 3:112843826-112843848 ACACACAGGCTGAAAGTAAAGGG + Intronic
960777351 3:121272487-121272509 ACACATAGGCTGAAAGTGAAGGG - Intronic
960850673 3:122050127-122050149 ACACATAGGCTGAAAGTATAAGG - Intergenic
962489184 3:135874992-135875014 ACACATAGGCTGAAAGTGAAGGG + Intergenic
963725524 3:148916237-148916259 ACACAAAGGTTAAAAGTAGAAGG + Intergenic
963976882 3:151490165-151490187 ACACATAGGCTGAAAGTGAAGGG + Intergenic
964505513 3:157394846-157394868 AATCAATGGGTGAAAGTAGAAGG - Intronic
964543145 3:157802389-157802411 ACTCAAAGGCTCAAAATAGAGGG - Intergenic
965680766 3:171248911-171248933 ATTCAAAGGCTGAAAGAAAAAGG - Intronic
967573092 3:191054158-191054180 AATCAAAGGCTTAAAGTTGGAGG - Intergenic
970262447 4:14242216-14242238 ACTCTATGGCTGAAAGTTCATGG - Intergenic
970581414 4:17477419-17477441 ACTCAAGGGCTGAGAATCAAAGG + Intronic
971096219 4:23407265-23407287 ACTCACAGGCTTAAAGTAAATGG - Intergenic
971263349 4:25076660-25076682 TCCCAAAGGCTGGAAGTCTATGG - Intergenic
972370730 4:38420746-38420768 ACTCAAATGCTGAAAGTGGCTGG + Intergenic
973579578 4:52329262-52329284 ACTCACAGACTGAAAGTGAAGGG - Intergenic
974162883 4:58162890-58162912 ATTCAAAGGCTAAAAGGCAATGG - Intergenic
976521598 4:86034206-86034228 ATTCAAAGGGTGAAAGTCACAGG - Intronic
976864101 4:89703530-89703552 ACTGAAAGGCTGAATGTCTGAGG - Intergenic
977093478 4:92709014-92709036 ACTCACAGGCTGAGAGTTGGTGG + Intronic
977505255 4:97893934-97893956 ACAGAAAGGGTAAAAGTCGATGG + Intronic
977670493 4:99689558-99689580 ACACATAGGCTGAAAGTGCAGGG - Intergenic
977872515 4:102109018-102109040 ACACACAGGCTGAAAGTGAAAGG + Intergenic
977946119 4:102916217-102916239 ACACAAAGGTTGAAAGTGAAAGG + Intronic
979950824 4:126891443-126891465 ACTGAAAGTCGGAAAGTCTAAGG + Intergenic
980454753 4:133024342-133024364 ACTCACAGGCTCAAAGTAAAAGG + Intergenic
980455833 4:133041601-133041623 ACACAAAAGCTGAAAGTGAAGGG + Intergenic
981283475 4:142988333-142988355 ACACAGAGGCTGAAATTGGAAGG - Intergenic
983543066 4:168933289-168933311 ACACAAAGACTGAAAGTGAAGGG + Intronic
983579831 4:169297309-169297331 ACTCAAAGACTGAAAATAAAGGG + Intergenic
984171575 4:176366368-176366390 ACTCACAGGCTCAAAGTAAAGGG - Intergenic
985262983 4:188132004-188132026 ACTCAGAAGCAGAAAGTAGAAGG - Intergenic
986327833 5:6690976-6690998 ACTAACAGGCTGGAAGTTGAAGG + Intergenic
987752886 5:22064869-22064891 ACTCACAAGATGAAAGTCTAGGG - Intronic
988143901 5:27279044-27279066 ACTGAAACACTGAAAGTAGATGG + Intergenic
989300701 5:39889027-39889049 ACTCACAGGCTGCAAGTTGCAGG + Intergenic
991161068 5:63503767-63503789 ACTCATAGGCTCAAAGTAAAGGG - Intergenic
993360198 5:86965458-86965480 ACTCAAAGGATAAATGTTGAGGG + Intergenic
993981568 5:94548691-94548713 ACACAAAGACTGAAAACCGAGGG + Intronic
994236816 5:97372177-97372199 ACTCATAGGCTCAAAGTAAAGGG + Intergenic
994311930 5:98283025-98283047 ACTCAAAGGCAAATAGTCCAGGG - Intergenic
995825057 5:116287440-116287462 ACACATAGGCTGAAAGTGAAAGG - Intronic
996474203 5:123896638-123896660 ACTCAAAAGCCTAAAGTCCAAGG + Intergenic
996952262 5:129141403-129141425 TCTCAAAGTCTGAAAGTACATGG - Intergenic
997410125 5:133684609-133684631 ACTCGAAGGCAGAAAGACCAGGG - Intergenic
997771014 5:136553785-136553807 ACACATAGGCTGAAAGTAAATGG - Intergenic
998751525 5:145327479-145327501 ACACATAGGCTGAAAGTGAAGGG - Intergenic
1000055624 5:157603612-157603634 ACTCAGAGGCTGGAAATCAAAGG + Intergenic
1001240486 5:170065898-170065920 ACTCATAGACTGAAAGTGAAGGG + Intronic
1001464144 5:171947396-171947418 ATTAAAAGGCTTAAAGTCCAGGG + Intronic
1002657603 5:180763320-180763342 ACACAAAGGCTGAAAGTAAAGGG + Intergenic
1002679763 5:180951956-180951978 ACTCAAAGGATGAGGTTCGAAGG - Intergenic
1008248869 6:49212417-49212439 ACTCATAGGCTCAAAGTAAAGGG + Intergenic
1008716233 6:54293490-54293512 ACCCATAGGCTGAAAGTGAAGGG - Intergenic
1011696177 6:89915410-89915432 ACACATAGACTGAAAGTAGAGGG - Intergenic
1012862971 6:104583217-104583239 ACTGAAAGGTTGAAATTCTAGGG - Intergenic
1014563186 6:122915321-122915343 ACTCACAGGCTGAAAGTTAAGGG - Intergenic
1016075105 6:139786742-139786764 ACCCATAGGCTGAAAGTAAAGGG - Intergenic
1016192352 6:141286349-141286371 ACACATAGGCTGAAAGTGAAGGG - Intergenic
1016572245 6:145527639-145527661 ACCCATAGGCTCAAAGTAGAGGG - Intronic
1016646570 6:146416075-146416097 ACACAAAAGGTGAAAGTCAAAGG - Intronic
1018248462 6:161844425-161844447 ACTCTAAGCCTGAAAGGCCATGG + Intronic
1018636716 6:165867298-165867320 ACACATAGACTGAAAGTGGAGGG + Intronic
1019592730 7:1843874-1843896 ATTCAGAGGCTGACAGCCGAGGG - Intronic
1020364436 7:7365468-7365490 GCTCAAAGGCTGAAAGAGAATGG - Intronic
1020623964 7:10555551-10555573 ACACATAGGCTGAAAGTGAAAGG + Intergenic
1020987451 7:15154471-15154493 ACCCAAAGGCTCAAAGTAAATGG - Intergenic
1021630742 7:22644312-22644334 ACACATAGGCTGAAAGCAGAGGG - Intergenic
1024452695 7:49565818-49565840 ACTCACAGGCTCAAAGTAAAAGG + Intergenic
1025166728 7:56718895-56718917 AATCCAAGGCTGAAATTCAAAGG + Intergenic
1026495748 7:70901185-70901207 ACACATAGGCTGAAAGTGAAAGG - Intergenic
1027507966 7:79042395-79042417 ACTCATAGGCTCAAAGTAAAGGG - Intronic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1030776517 7:113539733-113539755 ACACAGAGGCTGAAAGTGAAAGG + Intergenic
1035293371 7:157854048-157854070 ACTCACAGGCTGGGAGTCCAGGG - Intronic
1035817465 8:2556890-2556912 ACTCAAAGGATCAGAGTAGAAGG + Intergenic
1038184408 8:25259926-25259948 GTTCAAAGGCAGAAAGTCAAGGG - Intronic
1039264676 8:35811350-35811372 ACTCAAAGGCTCAAAATAAAGGG + Intergenic
1040811957 8:51463400-51463422 ACTCAAAGGCTCAAAGTAAAAGG + Intronic
1040825664 8:51618240-51618262 AAGCAAAGTCTGAAAGGCGAGGG + Intronic
1040967211 8:53095139-53095161 ACATAAAGGCTGAAAGTGAAAGG + Intergenic
1041887840 8:62832524-62832546 ACTCATAGGCTCAAAGTAAAAGG + Intronic
1041959141 8:63592025-63592047 ACACACAGGCTGAAAGTGAAGGG - Intergenic
1043640980 8:82450349-82450371 ACTCATAGGCTCAAAGTAAAGGG - Intergenic
1043950162 8:86299780-86299802 ACTCAAAGGCAGAGAGAAGAAGG - Intronic
1044025449 8:87165616-87165638 ACACATAGGCTGAAAGTGAAGGG - Intronic
1044165523 8:88978199-88978221 AATCTAAGGCTGAAATTCAAGGG - Intergenic
1044489399 8:92794162-92794184 AATCAAATGCTGAAAGTGTAAGG + Intergenic
1044509875 8:93062536-93062558 AATCATAGGCTGAAAGTGAAAGG + Intergenic
1045577470 8:103440641-103440663 ACTCAAAGGCTGCAAGTCCCTGG + Intronic
1045785927 8:105920083-105920105 ACCCATAGGCTCAAAGTAGAGGG + Intergenic
1048322725 8:133413106-133413128 ACACATAGGCTGAAAGTAAAAGG - Intergenic
1050651248 9:7779154-7779176 ACTCAGAGGGTGGAAGTGGAGGG + Intergenic
1050794376 9:9519245-9519267 AAACAAAGGCTGAAAATCAATGG + Intronic
1050956221 9:11664707-11664729 ACACATAGGCTGAAAGTAAAGGG - Intergenic
1051769317 9:20558987-20559009 ACTAAAAGGCTGAATGATGAGGG + Intronic
1052510962 9:29419976-29419998 ACACAAAGGCTGAAAGTGAAGGG + Intergenic
1056327958 9:85496432-85496454 ACACAAAGGCTGAATGTGAAGGG + Intergenic
1062296399 9:135830338-135830360 ACACACAGGCTGAAAGTGAAGGG + Intronic
1186985244 X:15006037-15006059 ACACATAGGCTGAAAGTGAAGGG + Intergenic
1188049155 X:25463470-25463492 ACACACAGGCTGAAAGTGAAGGG - Intergenic
1188706164 X:33334013-33334035 ACAGAAAGGGTGAAAGTCAATGG - Intronic
1189006102 X:36997001-36997023 ACACACAGGCTGAAAGTGAAAGG + Intergenic
1189169864 X:38898505-38898527 AGTCAAAGGCAGAAAGAGGAAGG + Intergenic
1189531046 X:41883496-41883518 ACTCAAAAGCTGAAAGAAAAGGG + Intronic
1191725322 X:64273733-64273755 ACACATAGGCTGAAAGTGGAGGG + Intronic
1191972353 X:66831025-66831047 ACACATAGGCTGAAAGTAAAAGG - Intergenic
1192395618 X:70778020-70778042 ACACATAGGCTGAAAGTGAAGGG + Intronic
1193770118 X:85578180-85578202 ACTCATAGGCTCAAAGTAAAGGG + Intergenic
1193843829 X:86443607-86443629 ACTCAATGGCAAAAAGTTGAAGG - Intronic
1194099978 X:89692122-89692144 ACCCAAAGGCTCAAAGTAAAGGG - Intergenic
1194893765 X:99413965-99413987 ACTCATAGGCTCAAAGTAAAGGG - Intergenic
1199102983 X:143827381-143827403 ACTCAAAGCCTGGAAGAGGAAGG - Intergenic
1199913205 X:152309906-152309928 ACTCATAGGCTCAAAGTAAAGGG + Intronic
1200452979 Y:3353479-3353501 ACCCAAAGGCTCAAAGTAAAGGG - Intergenic
1201181819 Y:11355627-11355649 ACACAAAGGTTGAAAGTGGAAGG + Intergenic