ID: 1158932684

View in Genome Browser
Species Human (GRCh38)
Location 18:62336455-62336477
Sequence GCATGGAGGCAGAGCCTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 391}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158932673_1158932684 26 Left 1158932673 18:62336406-62336428 CCTTCCGTCACTTTGGGGACTCC 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1158932684 18:62336455-62336477 GCATGGAGGCAGAGCCTAGAGGG 0: 1
1: 0
2: 1
3: 42
4: 391
1158932675_1158932684 22 Left 1158932675 18:62336410-62336432 CCGTCACTTTGGGGACTCCTGGC 0: 1
1: 0
2: 1
3: 20
4: 220
Right 1158932684 18:62336455-62336477 GCATGGAGGCAGAGCCTAGAGGG 0: 1
1: 0
2: 1
3: 42
4: 391
1158932672_1158932684 29 Left 1158932672 18:62336403-62336425 CCTCCTTCCGTCACTTTGGGGAC 0: 1
1: 0
2: 0
3: 4
4: 89
Right 1158932684 18:62336455-62336477 GCATGGAGGCAGAGCCTAGAGGG 0: 1
1: 0
2: 1
3: 42
4: 391
1158932677_1158932684 0 Left 1158932677 18:62336432-62336454 CCTGAGCAGTTCGTGCAGCCCCA 0: 1
1: 0
2: 0
3: 5
4: 118
Right 1158932684 18:62336455-62336477 GCATGGAGGCAGAGCCTAGAGGG 0: 1
1: 0
2: 1
3: 42
4: 391
1158932676_1158932684 5 Left 1158932676 18:62336427-62336449 CCTGGCCTGAGCAGTTCGTGCAG 0: 1
1: 0
2: 1
3: 9
4: 117
Right 1158932684 18:62336455-62336477 GCATGGAGGCAGAGCCTAGAGGG 0: 1
1: 0
2: 1
3: 42
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158932684 Original CRISPR GCATGGAGGCAGAGCCTAGA GGG Intronic
900182601 1:1318919-1318941 GCAGGGAGGCAGGGGCTGGAGGG - Intronic
902277965 1:15352994-15353016 GCAGGGAGGGAGAGACGAGAGGG + Intronic
903475109 1:23614105-23614127 GCAGGGCGGCAGAGCTTAGAGGG - Intronic
904255168 1:29250086-29250108 GCATCTAAGCAGAGCCAAGAAGG - Intronic
905007458 1:34721333-34721355 GCTGGAAGGCAGAGGCTAGAGGG - Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
906871293 1:49484562-49484584 TCATGGAGACAGAGAGTAGAAGG + Intronic
906889149 1:49688248-49688270 TCATGGAGGTGGAGACTAGAAGG - Intronic
906906426 1:49898933-49898955 TCATGGAGACAGAGAGTAGAAGG + Intronic
907058242 1:51392624-51392646 GAATGGAGGCAGAACATATAGGG - Intronic
907762825 1:57378135-57378157 GGATGGAGGCAGGGTCTGGAGGG + Intronic
908304653 1:62799952-62799974 CCATGGAGGCAGAGAGTGGAAGG - Intronic
910188446 1:84570943-84570965 GCCTGGAGGCAGAGACAACATGG + Intronic
910667177 1:89738515-89738537 GGCTGGAGGCAGAGCAGAGAGGG - Intronic
911267870 1:95764276-95764298 ACATGGAGACAGAGAGTAGAAGG + Intergenic
911698128 1:100916790-100916812 TCATGGAAGCAGAGAGTAGAAGG - Intronic
912861427 1:113217189-113217211 GCAGGAAGACAGAGCCAAGAGGG - Intergenic
913166148 1:116187586-116187608 TCATGGAGATAGAGCATAGAAGG - Intergenic
916729734 1:167555121-167555143 TCATGGAGACAGAGAGTAGAGGG - Intergenic
917300059 1:173563882-173563904 TCATGGAGGTAGAGAGTAGAGGG - Intronic
919763191 1:201111130-201111152 GCAAGGAGGGAGGGCCTAGGAGG + Intronic
919797733 1:201331500-201331522 GCATGGAGGTAGAAGCTGGAAGG - Exonic
920300417 1:204985284-204985306 GCATGGTAGCAGAGCTTGGATGG - Intronic
921241613 1:213189830-213189852 TCATGGAGACAGAGAGTAGAAGG - Intronic
921718992 1:218449848-218449870 TCATGGAGGCAGAGCCTTTATGG - Intergenic
922750693 1:228068803-228068825 GCATGGGGGGATAGCCTAGGGGG + Intergenic
923024091 1:230190604-230190626 TCAGGGAGTCAGAGCCCAGAGGG - Intronic
923258395 1:232242654-232242676 TCATGGAGGTAGAGAGTAGAAGG + Intergenic
923774875 1:236969225-236969247 CCATGGAGGCACAACCTAGAGGG + Intergenic
1062796489 10:348425-348447 GTGTGGAGGCAGAGGCTGGATGG - Intronic
1062845375 10:699255-699277 TCATGGAGTCAGAGGCTGGAGGG - Intergenic
1062923564 10:1297807-1297829 CCATGGAGGCAGGGGCTGGAGGG + Intronic
1063539182 10:6914800-6914822 AAAGGGAGGCAGAGCATAGAAGG + Intergenic
1063673468 10:8118493-8118515 GCATGGAGGGAAAGCTTTGAAGG + Intergenic
1064219477 10:13428281-13428303 GCATGGAAGCGGACCCCAGAAGG - Intergenic
1064473321 10:15659797-15659819 GGATGGAGGCAGAGACTGGTGGG + Intronic
1065046699 10:21752398-21752420 AGATGGGGGCAGAGCCGAGAGGG + Intergenic
1065461489 10:25970431-25970453 GCATTTAAGCAGTGCCTAGAAGG + Intronic
1065485312 10:26231215-26231237 GGAGGGAGGAAGGGCCTAGAGGG + Intronic
1065508535 10:26454530-26454552 TCATGGAGGTAGAGAGTAGAAGG + Intronic
1065876927 10:30005220-30005242 TCATGGAGACAGAGAGTAGAAGG - Intergenic
1066649554 10:37641585-37641607 TCATGGAGGTAGAGAGTAGAAGG - Intergenic
1067523642 10:47026010-47026032 GCAGGGAGGCAGAGGGCAGATGG - Intergenic
1067929066 10:50541485-50541507 TCATGAAGACAGAGCCTGGATGG - Intronic
1070279046 10:75035535-75035557 GCATGGAGGCAGAGAAAAGTGGG - Intergenic
1070483551 10:76909099-76909121 GCATGGAGGCAAGGCCTGGCTGG - Intronic
1070817215 10:79332096-79332118 GCGTGGAAGCAGAGCCCAGAAGG - Intergenic
1072215603 10:93284916-93284938 GCCTGGCCGAAGAGCCTAGAAGG - Intergenic
1073535090 10:104269169-104269191 GCAAGGAGGCGGGGCCTAGACGG - Exonic
1074014074 10:109515411-109515433 TCATGGAGGCAAAACCTAGAAGG - Intergenic
1074062949 10:109984556-109984578 GCATGGGGTGGGAGCCTAGAGGG - Intergenic
1074913016 10:117928984-117929006 GGATGGAGGCAGACACTGGACGG - Intergenic
1076070613 10:127485331-127485353 GCAGGGAGGCTGAGCCAGGATGG - Intergenic
1076230693 10:128817770-128817792 GCATGGAGTCAAAGGCTGGAGGG + Intergenic
1076422402 10:130340667-130340689 GGATGGAGGCAGAGGCTGGAGGG - Intergenic
1076541673 10:131219100-131219122 GCCTGCAGGCAGAGCCAGGACGG - Intronic
1076757272 10:132579141-132579163 GCAGGGAGGCAGAGCCGCGCCGG + Intronic
1077017998 11:405441-405463 CCATGCAGGCAGATCCTGGATGG - Intergenic
1077195334 11:1277022-1277044 GCATCGAGGCAGAGGCTCTATGG + Exonic
1077357364 11:2124676-2124698 GCGTGGGGGCAGAGACTGGAAGG - Intergenic
1077357374 11:2124723-2124745 GCGTGGGGGCAGAGACTGGACGG - Intergenic
1077450589 11:2640861-2640883 TCATGGAGGTAGAGAGTAGAAGG - Intronic
1077546312 11:3171711-3171733 GGATGGAGGCAGAGATTGGAGGG - Intergenic
1078058838 11:8030848-8030870 GCATGGAGGCAGAGCCAGGCTGG - Intronic
1078451533 11:11444152-11444174 GCAGGGAGGCGGGGCCTGGAGGG - Intronic
1078451547 11:11444201-11444223 GCAGGGAGGCGGGGCCTGGAGGG - Intronic
1078451561 11:11444250-11444272 GCAGGGAGGCAGGGCCTGGAGGG - Intronic
1078612130 11:12830040-12830062 GCATGGACACAGAGGCCAGAAGG + Intronic
1079166546 11:18049461-18049483 TCATGGAGACAGAGAATAGAAGG + Intergenic
1079279650 11:19075788-19075810 ACATGGAGACAGAGCCAGGAGGG + Intergenic
1080150054 11:29041602-29041624 GCATGGGGGCAGAGTCCAGTGGG + Intergenic
1082067375 11:47911604-47911626 CCAAGAAGGCAGAGCCTGGAGGG + Intergenic
1082189198 11:49221962-49221984 GCATGGAGGTAGAGAGCAGAAGG - Intergenic
1084177727 11:67432143-67432165 GCATGGAGGCAGAAGCTCGCAGG - Intronic
1084890437 11:72234158-72234180 GCAAGGAGGCAGGGCCAGGAGGG - Intronic
1085412908 11:76302120-76302142 GAAAGGAGGCAGAGACTGGAAGG - Intergenic
1086889988 11:92246282-92246304 GCATGTAGGCAGAGAGGAGAGGG + Intergenic
1087533758 11:99416738-99416760 GCAAGGAGGCAGAGGCTGGAGGG + Intronic
1089105143 11:115996797-115996819 AGATGGAGGAAGATCCTAGAAGG + Intergenic
1090676353 11:129000806-129000828 TCATGGAGACAGAGAGTAGAAGG - Intronic
1092258655 12:6940872-6940894 GCACCGAGGCAGAGGCTGGAGGG - Exonic
1093195980 12:16129999-16130021 AGATGGAGGCAGAGACTGGAGGG + Intergenic
1096778214 12:53976505-53976527 GCAGGCAGGCAGAGCCCAGCGGG + Exonic
1097195668 12:57241308-57241330 TCGTGGAGGGAGAGCCTAAAGGG + Intergenic
1097338052 12:58406745-58406767 GCATAAAAGCAGAGGCTAGAGGG + Intergenic
1097490757 12:60267684-60267706 GAATGGAGGTAGAGAATAGAAGG - Intergenic
1097655912 12:62363330-62363352 GCATGGGGCCAGATCCTACAGGG - Intronic
1098132876 12:67368591-67368613 TAATTGAGGCAGAGCCTAAATGG - Intergenic
1099901380 12:88714867-88714889 AGATGGAGGAAGAGCCAAGATGG - Intergenic
1106019396 13:25900113-25900135 GCTGGGAGGCAGAGCTGAGAGGG + Intronic
1109443608 13:62405804-62405826 GCAGCGAGGCAGGGTCTAGAAGG - Intergenic
1109903224 13:68802161-68802183 GCATGGGGGCAGATCCTTCATGG + Intergenic
1110246729 13:73333967-73333989 GTAAGGAGGCAGAGCATAAAAGG + Intergenic
1111020002 13:82437203-82437225 TGTTGGAGGAAGAGCCTAGAGGG + Intergenic
1112478472 13:99753037-99753059 GCATGTAGGCTGAGCCTTGAGGG + Intronic
1113837124 13:113335649-113335671 TCATGGAGGCAGAGAGTAGAAGG - Intronic
1114633897 14:24176864-24176886 TCCTGGAGGCAGAGCCCATACGG + Exonic
1115908952 14:38234238-38234260 ACATGGAGGCAGGCTCTAGAAGG - Intergenic
1115924937 14:38422034-38422056 TCATGGAGACAGAGAATAGAAGG - Intergenic
1116873626 14:50090759-50090781 GAAGGGTGGAAGAGCCTAGAGGG - Intronic
1117420404 14:55539162-55539184 GCATGGCAGCAGTGCCTAAAAGG - Intergenic
1117852615 14:59991327-59991349 GTATCGGGGCAGAGCCAAGATGG + Intronic
1118142080 14:63095012-63095034 GCATGGAGGCAGAGCTCAGGTGG + Intronic
1118725884 14:68628688-68628710 GCGTGGAGGCAGAGGGTAGGGGG + Intronic
1121100091 14:91244587-91244609 GTTTGAAGGCAGAGCCTAGCTGG - Intronic
1121597610 14:95177660-95177682 TCATGGAGACAGAGAGTAGAAGG - Intergenic
1122640157 14:103155253-103155275 GCCTGGAGGCTGAGCCTGGCAGG + Intergenic
1122890157 14:104728516-104728538 GCCTGCAAGCAGAGCCCAGAAGG + Intronic
1124121057 15:26888894-26888916 GCAAGGAGGGAGTCCCTAGAAGG + Intronic
1124388203 15:29227278-29227300 GCCTGGTGGCAGAGCCATGAGGG - Intronic
1125278223 15:38016153-38016175 GTATGGAGGCAGGGGCTATATGG + Intergenic
1126503416 15:49374617-49374639 CCTGGGAGGCGGAGCCTAGATGG - Intronic
1126965937 15:54053819-54053841 GCATGGAGATAGAGAGTAGACGG - Intronic
1127351730 15:58159691-58159713 TCATGAAGGCAGAGAGTAGATGG - Intronic
1129094745 15:73193884-73193906 GCATGTGAGCCGAGCCTAGAAGG + Intronic
1129457425 15:75683248-75683270 GCAGGGAGGCTGGGCCTGGAGGG - Intronic
1129702138 15:77774159-77774181 GTGTGGGGGCACAGCCTAGAGGG + Intronic
1129726366 15:77903697-77903719 GCAGGGAGGCTGGGCCTGGAGGG + Intergenic
1130288279 15:82573183-82573205 GCACTCAGGCATAGCCTAGAAGG + Intronic
1131121395 15:89825203-89825225 GCATGGAGTCAGAGGCTACGAGG - Intergenic
1133466728 16:6034579-6034601 GCATGAAGGCAGAGTCTTCATGG + Intronic
1135107758 16:19665360-19665382 CCATGGAGACAGAGAGTAGAAGG - Intronic
1136251359 16:29007603-29007625 CCTGGGAGGCGGAGCCTAGATGG + Intergenic
1136287984 16:29255158-29255180 GGACGGAGGCAGAGCCTGGCGGG - Intergenic
1137861473 16:51850906-51850928 GCACAGAGGGAGAGCCCAGAGGG - Intergenic
1139374712 16:66489734-66489756 GCACAGAGGCAGAGGCTGGAGGG + Intronic
1142093653 16:88227925-88227947 GGATGGAGGCAGAGCCTGGCGGG - Intergenic
1142128925 16:88423576-88423598 GGATGCAGGCACAGCCTAGCGGG + Intergenic
1142154057 16:88525195-88525217 GCAGGGAGGCCGAGCCTGGCTGG + Intronic
1142267259 16:89070438-89070460 GCATGGGGAGAGAGCCTAGCTGG - Intergenic
1142276783 16:89122997-89123019 GCATGCAGGCAGACCCTGCAAGG + Intronic
1146634701 17:34495256-34495278 GCAGGGAGGCAGAGCCAAGGTGG + Intergenic
1146652433 17:34614906-34614928 CCATGGGAGCAGAGTCTAGAGGG + Intronic
1148043271 17:44725640-44725662 GGATGGAGGCAGAAGGTAGATGG - Intronic
1148772977 17:50077514-50077536 GCAGGCAGGCAGAGGCTGGAAGG - Intronic
1149040376 17:52181521-52181543 GCATGGAGGCAGAGGCAAGATGG + Intergenic
1150708155 17:67507123-67507145 GGATAGAGGCAGGGCCTTGATGG + Intronic
1150909367 17:69371857-69371879 GGATGGAGGCAGATCCTTGTGGG + Intergenic
1150981028 17:70141738-70141760 TCATGAAGGCAGAGCCTCCATGG + Intergenic
1151517785 17:74607568-74607590 CCATGGAGGCAGAGCCATGGAGG + Intergenic
1151953656 17:77369795-77369817 CCATGGAGGCTGTGCCTGGAGGG + Intronic
1151968770 17:77446295-77446317 GGATGGAGGCAGAGGCTGGAGGG - Intronic
1152458227 17:80428064-80428086 GGATGGGGGCAGACCCTAGCAGG - Intronic
1152676667 17:81644894-81644916 GCATGGTGGCAGAGCCTTCGAGG - Intronic
1156467141 18:37354741-37354763 GCATGGTGGGAAGGCCTAGAGGG - Intronic
1156475124 18:37401089-37401111 GCTGTGAGGCAGGGCCTAGATGG + Intronic
1157319559 18:46623840-46623862 GCAGAGAGGCAGAGCCATGAGGG + Intronic
1157331276 18:46705527-46705549 GGAAGGTGGCAGAGCCAAGATGG + Intronic
1157588188 18:48818553-48818575 GCATGGAGGTAGGGGATAGAGGG + Intronic
1157693002 18:49698949-49698971 GCATTGAAGCTGAGCCTTGAAGG - Intergenic
1158515153 18:58124463-58124485 GGATGGAGACAGAGCACAGAAGG - Intronic
1158932684 18:62336455-62336477 GCATGGAGGCAGAGCCTAGAGGG + Intronic
1159959542 18:74544979-74545001 ACACGGAGGCAGAGACTGGAAGG + Intronic
1160044216 18:75371816-75371838 GTATGGAGGCAGAGCCCAGGTGG - Intergenic
1160121046 18:76130754-76130776 CGATGGAGGCAGAGCGTGGAGGG + Intergenic
1160440247 18:78884108-78884130 GCATGGAGGTAGAGCAGAGAAGG - Intergenic
1160471586 18:79139852-79139874 TCATGGAGACAGAGAGTAGAAGG - Intronic
1161081623 19:2313244-2313266 GCATGGACGCAGCACCTAGTAGG - Intronic
1161447950 19:4328540-4328562 GGACGGAGCCAGAGCCGAGACGG - Intronic
1163005305 19:14393671-14393693 GCATTCAGGCAGAGCACAGAGGG + Intronic
1163632278 19:18423667-18423689 GCAGGGAAGCAGAGCCAGGATGG - Intronic
1164572680 19:29385535-29385557 GCATGGAATCAGAGCTTTGAGGG + Intergenic
1164732193 19:30514685-30514707 GCATGGAAGCACAGCCTGGAGGG - Intronic
1164770149 19:30802076-30802098 GCATCATGGCAGTGCCTAGAAGG + Intergenic
1164883365 19:31755938-31755960 GCATGGAGCCAGGGCAAAGAAGG - Intergenic
1166126934 19:40720577-40720599 CCATGGAGGCAGATTCTGGAAGG - Intronic
1167627236 19:50599741-50599763 GCAAAGAGGCAGGGGCTAGAGGG + Intergenic
1168318968 19:55497758-55497780 GAATGGAGGGAAGGCCTAGATGG + Intronic
1168498380 19:56873181-56873203 GCATGGAGGATGAGCTTACAAGG - Intergenic
925058816 2:875638-875660 GCATGAGGGCAGAGCCTGGGTGG + Intergenic
925158460 2:1664403-1664425 GCATAAAGGCACAGCCTGGATGG - Intronic
926233138 2:11019898-11019920 GAGAGGAGGCAAAGCCTAGAGGG - Intergenic
927466297 2:23339357-23339379 GCCTGGTGGCAGAGCTCAGAGGG - Intergenic
927671689 2:25073824-25073846 GAATTGAGGCAGAGCCTGGAAGG - Intronic
929031018 2:37649793-37649815 GCATGGAGGCAAAGGTTGGAGGG + Intronic
929274908 2:40014601-40014623 ACATGGAGGAGGAGCCAAGATGG - Intergenic
930522239 2:52482034-52482056 CCATAGAGGCAGAGGGTAGAAGG + Intergenic
930564472 2:53002167-53002189 TCATGGAGACAGAGAGTAGAAGG - Intergenic
930566396 2:53025954-53025976 ACATGGAGGTAGAGAGTAGAAGG + Intergenic
930635868 2:53804835-53804857 GCATGGAGATAGAGAGTAGAAGG - Intronic
932086212 2:68764695-68764717 GCATGGAGGCAGGGAACAGATGG - Intronic
932118754 2:69078493-69078515 GCATGGAGGCACAGCCATGCTGG - Intronic
932751054 2:74371943-74371965 GGATGGAGGCAGAGGAGAGAGGG + Intronic
933685250 2:85136217-85136239 GCATGGAGAAATAGCCTTGAGGG - Intronic
934122549 2:88854149-88854171 CCAAGGAGGCAGAGACCAGAGGG - Intergenic
935561671 2:104566199-104566221 GCATGGACACAGAGAGTAGAAGG + Intergenic
935730575 2:106062015-106062037 CCTTGGAGGCAGAGTCAAGATGG + Intergenic
936498065 2:113039908-113039930 GCATGCAGGCAGATCCTGGAGGG + Intronic
937209923 2:120261877-120261899 GGATGGAGGCTGAGGCTAGAGGG + Intronic
937467903 2:122151118-122151140 GCATAGAGGCAGAGGCTATGCGG + Intergenic
937475789 2:122214163-122214185 GTATGGAAGCAGAGACCAGAGGG - Intergenic
937988758 2:127650708-127650730 GGCTGGAGTCAGAGCCTGGAGGG - Exonic
939558223 2:143702694-143702716 GCAAGGAGACAGAGCCTCTAGGG - Intronic
941286054 2:163613422-163613444 GCTTGGAGGAAGAGCACAGAAGG - Intronic
943430057 2:187788591-187788613 TCATGGAGACAGAGAGTAGAGGG + Intergenic
943455642 2:188103505-188103527 GCATGGAGGCAAGGCATTGATGG - Intergenic
944208747 2:197184664-197184686 GCATGGAGGAAAAGCATGGAAGG - Intronic
944751098 2:202710743-202710765 TCATGGAGACAGAGAGTAGAAGG - Intronic
945215014 2:207424064-207424086 ACATGGAGGAAGTGCCTGGAGGG - Intergenic
946051539 2:216866865-216866887 GCAAAGAGGCAGGGGCTAGAGGG + Intergenic
946256940 2:218449275-218449297 CCATCGAGGCAGAGCAGAGAAGG - Exonic
946851861 2:223915518-223915540 GAATAGAGACAGAGACTAGAGGG - Intronic
948340930 2:237251022-237251044 GACTGGAGGCAGAGCTTAGGCGG - Intergenic
1168978970 20:1988883-1988905 CCAGGGAGGCAGAGCCAACAAGG - Intronic
1168998775 20:2151444-2151466 GCTTGGAGGCAGAGCCTGAGGGG - Intronic
1169541958 20:6609389-6609411 TCATGGAGATAGAGACTAGAAGG + Intergenic
1169976393 20:11333368-11333390 GCTTTGAGCCAGAGCATAGAGGG - Intergenic
1170947961 20:20908983-20909005 GCAAAGAGGCAGGGGCTAGAGGG + Intergenic
1171027077 20:21640590-21640612 GCAGGAAGACAGAGCCAAGATGG + Intergenic
1171062890 20:21983457-21983479 GCATGGAGGTAGATCCAAGAAGG - Intergenic
1171503930 20:25618051-25618073 GTATGGATGCAGATCCCAGATGG - Intronic
1172493365 20:35359767-35359789 CCAAGAAAGCAGAGCCTAGATGG + Intronic
1174104806 20:48154603-48154625 GGGAGGAGGCAGAGCCCAGAGGG + Intergenic
1174884031 20:54311967-54311989 GCTTGGAGGTGGAGCCTAGTGGG - Intergenic
1175451461 20:59072344-59072366 CAATGGAGGCAGAGGCTGGAGGG + Intergenic
1175921778 20:62453542-62453564 GCAGGTGGGCAGAGCCTCGAGGG + Intergenic
1177105692 21:16952855-16952877 TCATGGAGACAGAGAGTAGAAGG + Intergenic
1177497589 21:21909935-21909957 GCATGGAGGCAGACCCCACCAGG + Intergenic
1177565650 21:22818075-22818097 TCATGGAGGCACAGCCTGCATGG - Intergenic
1178206913 21:30478873-30478895 TCATGGAGGTAGAGAATAGAAGG - Intergenic
1178211797 21:30543007-30543029 TCATGGAGATAGAGACTAGAAGG - Intronic
1178286275 21:31328045-31328067 GCATCGAGGCAGAGGGCAGAGGG - Intronic
1178600603 21:33991247-33991269 GCATGGAGGCACAGACTTTATGG + Intergenic
1179897585 21:44371239-44371261 ACACGGAGGCAGAGACTGGAGGG - Intronic
1179897615 21:44371347-44371369 ACACGGAGGCAGAGACTGGAGGG - Intronic
1179897625 21:44371383-44371405 ACACGGAGGCAGAGACTGGAGGG - Intronic
1179897635 21:44371419-44371441 ACACGGAGGCAGAGACTGGAGGG - Intronic
1179897645 21:44371455-44371477 ACACGGAGGCAGAGACTGGAGGG - Intronic
1179897655 21:44371491-44371513 ACACGGAGGCAGAGACTGGAGGG - Intronic
1179897665 21:44371527-44371549 ACACGGAGGCAGAGACTGGAGGG - Intronic
1181456260 22:23061766-23061788 GCAGGGAGGGAGACCCTAGCAGG - Intronic
1182100365 22:27653531-27653553 CCATGGAGACAGAGAGTAGAAGG + Intergenic
1182108119 22:27703881-27703903 GGATGGAGGCAGAGACTGGAGGG - Intergenic
1183064166 22:35352333-35352355 GAATGGACCCAGGGCCTAGAGGG - Intergenic
1183746330 22:39694112-39694134 GCAAGGAGGCACAGCCTGGAGGG + Intergenic
1183999451 22:41662031-41662053 TCATGGAGAGAGAGCATAGAAGG + Intronic
1184435168 22:44469039-44469061 TGATGGAAGCAGAGCCTGGAGGG - Intergenic
1184924177 22:47625868-47625890 GCAGGGAGGCAGGGCGAAGACGG - Intergenic
950898658 3:16476571-16476593 GCATTTAGGCAGAGACTATAAGG + Intronic
951102738 3:18708267-18708289 TCATGGAGACAGAGAATAGAAGG + Intergenic
951900348 3:27651622-27651644 TCATGGAGGTAGAGAATAGAAGG - Intergenic
952230366 3:31423356-31423378 GCTTTGAGGCTAAGCCTAGATGG + Intergenic
953792332 3:45957837-45957859 ACAGGGAGGCAGAGCTGAGACGG - Intronic
954226229 3:49182984-49183006 GTATGGAGGGAGAGGCCAGAGGG - Intronic
954421732 3:50422413-50422435 GCATTGAGGCTGAGGCTAGAGGG - Intronic
955028540 3:55193603-55193625 TCATGGAGACAGAGGGTAGAAGG - Intergenic
956319853 3:67984693-67984715 CCACAGAGGCAGAGACTAGAAGG - Intergenic
956775989 3:72565892-72565914 GCATGGAAGAAGAGCCTGGCTGG + Intergenic
957226878 3:77460457-77460479 GCATGGAGGCAGAACCAGCAGGG + Intronic
957434238 3:80152702-80152724 ATATGGGGGCAGAGTCTAGATGG - Intergenic
957827045 3:85461102-85461124 GAATGGAGGCAGAGCATATAAGG - Intronic
960474070 3:118102403-118102425 TCATAGAGGCAGAGAGTAGAAGG - Intergenic
961335740 3:126178976-126178998 GCAGGGAGGCAGAGTCCAGGTGG + Intronic
961818749 3:129564573-129564595 CTATGGTGGCAGAGGCTAGAGGG - Intronic
962094897 3:132283637-132283659 ACATGAAGGCAGAACTTAGAAGG - Intronic
963086292 3:141439636-141439658 AAATGGAAGCAGAGCCTAAAGGG + Intronic
963793301 3:149605991-149606013 TCATGGGGGCAGAGCCCACATGG + Intronic
964359344 3:155878108-155878130 GCATGAGGGCAGAGCCCACACGG - Intronic
966126316 3:176580864-176580886 GCATGGGGAAAGAGCTTAGAGGG + Intergenic
966821796 3:183930637-183930659 CAATGGAGGCAGAGGCCAGAGGG + Intronic
967751190 3:193118220-193118242 GCAAAGAGGCAGGGCCTGGAGGG + Intergenic
968076853 3:195820693-195820715 CGATGGAGGCAGAGGCTGGAGGG - Intergenic
968432554 4:567331-567353 GCGTGGAGGGACAGCCTAGGAGG + Intergenic
968718741 4:2182401-2182423 GGATGGAAGCAGAGACTGGAGGG + Intronic
968928193 4:3560975-3560997 GCCAGGAAGCACAGCCTAGAGGG - Intergenic
969269138 4:6086843-6086865 GGACGGAGGCAGAGGCTGGAGGG + Intronic
969686913 4:8680730-8680752 GCTTGCAGGCAGAAGCTAGAGGG + Intergenic
969704762 4:8785719-8785741 GCATGGAGGCAGAGACCACAGGG + Intergenic
970523059 4:16904627-16904649 GCCTGAAGGCAGACACTAGATGG - Intergenic
971284166 4:25271190-25271212 GAATGGAGCCAGAGTATAGAGGG + Intronic
971336542 4:25728561-25728583 GTATGGGGGCTGAGCCTTGATGG - Intergenic
973227689 4:47804668-47804690 TCATGGAGACAGAGAATAGATGG + Intronic
973879541 4:55255146-55255168 GCATGGATGCAGAGTCTGGCTGG + Intergenic
974895205 4:67929590-67929612 TCATGGAGGCAGTGCCTGGGTGG + Intronic
975149921 4:71009381-71009403 GCTTGGAATCAGAGCCCAGAGGG + Intronic
975319210 4:72991136-72991158 TCATGGAGATATAGCCTAGAGGG - Intergenic
976082358 4:81369568-81369590 GCATGGAGATAGAGAGTAGAAGG - Intergenic
977461900 4:97336787-97336809 GAATGGAGGCAGGGCCAAGATGG + Intronic
978684897 4:111428749-111428771 TCATGGAGGTAGAGAGTAGAAGG + Intergenic
979478397 4:121185189-121185211 GCATGAAGGAAGAGAGTAGAAGG - Intronic
979757361 4:124358543-124358565 GCATGGAGATAGAGAGTAGAAGG + Intergenic
981871864 4:149496578-149496600 GAATGCAGGCAGCTCCTAGAAGG + Intergenic
982217125 4:153092075-153092097 CCGTGGAGGCAGAGACTGGAGGG - Intergenic
983560153 4:169092802-169092824 GCATGGTTACAGAGCCTGGATGG + Intergenic
984496057 4:180498391-180498413 TCATGGAGACAGAGAGTAGAAGG - Intergenic
984764756 4:183391547-183391569 GCAAAGAGGCAGAGGCTGGAGGG - Intergenic
985287756 4:188354342-188354364 GCATGGAGGCTGAGCATCTAGGG + Intergenic
985950045 5:3216035-3216057 TCATGGAGACAGAGAGTAGAAGG + Intergenic
986332653 5:6728659-6728681 GCTGGGCGGCAGAGCCCAGAGGG + Intronic
986710755 5:10486499-10486521 CCATGGAGGCAGAGGTTACAGGG + Intergenic
987156527 5:15095197-15095219 GCAGAGAGGCAGAGCCCAGATGG - Intergenic
989330313 5:40250735-40250757 TCATGGAGGTAGAGAGTAGAAGG + Intergenic
991671985 5:69056888-69056910 TCATGGAGGCTGAGAGTAGAAGG - Intergenic
993446628 5:88020560-88020582 TGTTGGAGGCAGGGCCTAGAGGG - Intergenic
993987027 5:94609836-94609858 ACATAGAAACAGAGCCTAGAAGG + Intronic
994516770 5:100782241-100782263 GACAGGAGGCAGAGCCCAGATGG - Intergenic
995570702 5:113478139-113478161 ACATAGTGGCAGAGCCTAGAGGG + Intronic
996192165 5:120558328-120558350 TCATGGAGACAGAGTGTAGAAGG - Intronic
996459859 5:123729580-123729602 GCATGGACACAGAGAGTAGAAGG + Intergenic
998577092 5:143328028-143328050 CCATGGAGGCAGAGCCTTCATGG - Intronic
1000487081 5:161860440-161860462 CCATGGAGACAGAGAGTAGAAGG + Intronic
1002463524 5:179389198-179389220 GCAAGGAGGCCGAGCCCAGCAGG + Intergenic
1002700219 5:181118875-181118897 GCAGCGAGGCAGAGTCCAGATGG + Intergenic
1003149772 6:3538646-3538668 CCATGGACACAGAGCCCAGATGG + Intergenic
1006338360 6:33432414-33432436 GCAGGGGGGCAGAGCCAAGAAGG - Intronic
1006815331 6:36845937-36845959 GCATTGAGGCAGAGACCTGAGGG - Intergenic
1007168059 6:39842293-39842315 TCATGGACTCAGAGTCTAGATGG + Intronic
1007306573 6:40911380-40911402 GCTTGGAGGAAGGGCCAAGAGGG - Intergenic
1008190816 6:48454537-48454559 TCATGGACACAGAGACTAGAAGG - Intergenic
1009294572 6:61930022-61930044 TCATGAAGGCAGAGCCTTCATGG + Intronic
1009649212 6:66451637-66451659 TATTGGAGGCAGAGCCTAGTGGG + Intergenic
1010710945 6:79173524-79173546 CCATGGAGGCAGAGATTGGAGGG + Intergenic
1010839352 6:80629958-80629980 TCATGGAGACAGAGAGTAGAAGG + Intergenic
1011205909 6:84897397-84897419 GAACAGAGGCATAGCCTAGATGG + Intergenic
1011341999 6:86326483-86326505 TCATGGAGACAGAGAGTAGAAGG + Intergenic
1012994539 6:105960317-105960339 ACATGTATGCAGAACCTAGATGG + Intergenic
1013284544 6:108669834-108669856 GCATGGAGACAGAGCCTGAGTGG + Intronic
1014081870 6:117296614-117296636 CCATGGAGACAGAGAGTAGAAGG + Intronic
1014131924 6:117845366-117845388 GCATGGGGACAGGGCCAAGATGG + Intergenic
1015853447 6:137598816-137598838 TGATGGGGGCAGAGCCTAAAAGG - Intergenic
1016410175 6:143774727-143774749 GGATGGAGGCAGACCATTGAAGG - Intronic
1017963209 6:159240019-159240041 GCAGGGTGGCAGAGCCTGCAGGG + Intronic
1018943660 6:168329357-168329379 GCATGGAGGGAGGGCTCAGAAGG - Intergenic
1020865104 7:13550324-13550346 TCATGGAGACAGAGAGTAGAAGG + Intergenic
1022075372 7:26963655-26963677 GGATGGAGGCAGCGGCTATATGG + Intronic
1022227182 7:28375323-28375345 CCATGGAGACAGAGAGTAGAAGG + Intronic
1022846208 7:34212781-34212803 GGGAGGAGGCAGAGTCTAGAGGG - Intergenic
1023265262 7:38398504-38398526 TCATGGAGACAGAGAGTAGAAGG + Intronic
1024027324 7:45423829-45423851 GCATGGGGGCAGAGCCAGGAGGG - Intergenic
1024454196 7:49584377-49584399 ACATGGAGGCAGAGACTGGAGGG + Intergenic
1026417436 7:70197325-70197347 GGATGGAGGAGGAGCCAAGATGG + Intronic
1028054724 7:86227191-86227213 GCATTGTGGCAGAACCTACAGGG + Intergenic
1028433228 7:90772202-90772224 ACATGGAGGCAGAACCTACCTGG - Intronic
1029512847 7:101007431-101007453 TAATGGAGGCAGAGCGTAGAAGG - Intronic
1030684417 7:112469875-112469897 GCATTGAAGCAGAGGCTGGAGGG - Intronic
1031508942 7:122624910-122624932 GCATGGAGAAAAAGTCTAGAAGG + Intronic
1032089428 7:128903920-128903942 GGATGGAGGGAGAACCTAGCTGG + Intronic
1033500410 7:141943384-141943406 TCATGGAGATAGAGCATAGAAGG + Intronic
1033821196 7:145135927-145135949 TCATGGAGACAGAGAATAGAAGG - Intergenic
1033992527 7:147305935-147305957 AGATGGAGGCAGAGACTGGAGGG - Intronic
1034879712 7:154753773-154753795 GGATGGAGGGACAGCCTAGACGG - Intronic
1035700764 8:1638037-1638059 GCCTGGAGGGAGAGGCTGGAAGG + Intronic
1037296125 8:17402439-17402461 ACATGGAGACAGAGGGTAGAAGG - Intronic
1037966075 8:23135049-23135071 GCATGGAGGCTGAGCATGGAGGG - Intergenic
1038038672 8:23706443-23706465 GAATGGACGCAGAGCCGCGAGGG - Exonic
1038511284 8:28138107-28138129 GCCTGGAGACAGAGCCATGACGG + Intronic
1038642265 8:29338032-29338054 GCATGGCTTCAGTGCCTAGATGG - Intronic
1039431472 8:37528541-37528563 GCAGGGAGGGAGAGCTTAGTGGG - Intergenic
1039459133 8:37728784-37728806 GCATGGAAGCAGAGGCCAGTAGG - Intergenic
1039647031 8:39297813-39297835 TCATGGAGACAGAGAGTAGAAGG - Intergenic
1039807435 8:41012633-41012655 GCATAGAGGCAGAGGCTGGAGGG - Intergenic
1040691288 8:49941638-49941660 GCAGGCAGCCAGAGCCCAGAGGG - Intronic
1041768411 8:61445326-61445348 TGATGGAGGCAGAGCCTAGTGGG + Intronic
1041937260 8:63347845-63347867 GCCTGGAGACAGAGCCTTTATGG + Intergenic
1042065150 8:64866780-64866802 TCATGGAGATAGAGACTAGAAGG + Intergenic
1042591639 8:70403197-70403219 GCAGCGCGGCAGAGCCGAGAAGG - Intronic
1042853751 8:73243116-73243138 TCATGGAGATAGAGACTAGAAGG + Intronic
1043557614 8:81450641-81450663 CCATGGAGACAGAGAGTAGAAGG - Intergenic
1044122349 8:88412982-88413004 GCCTGGAGGCTGGGCCAAGAGGG + Intergenic
1044729732 8:95220260-95220282 GGATGGAGGGAGAGCTTGGATGG - Intergenic
1045405936 8:101866963-101866985 GAAGGGAGCCAGAGCATAGAGGG - Intronic
1045425982 8:102066148-102066170 GCAGGCAGGCAAAGCCTGGAGGG + Intronic
1045817598 8:106294694-106294716 TCATGGAGGCAGATCCTTCATGG - Intronic
1046290241 8:112149681-112149703 ACATGGAAGCAGAGCCTGGCAGG - Intergenic
1046553967 8:115753158-115753180 GGATGGAGGAGGAGCCAAGATGG + Intronic
1046748025 8:117896941-117896963 ACATGGAGGCAGAGGCTGGGGGG - Intronic
1047260835 8:123258089-123258111 TCTTGGAGGCAGAGCCTAATAGG + Intronic
1047430185 8:124784407-124784429 TCATGGAGATAGAGACTAGAAGG - Intergenic
1048017322 8:130509102-130509124 TCCTGGAGGCAGAGACTGGAGGG - Intergenic
1048722879 8:137347123-137347145 TCATGGAGGTAGAGAGTAGAAGG - Intergenic
1049173129 8:141174409-141174431 GGGTGGAGGCAGAGCCGAGCAGG + Intronic
1049222103 8:141432905-141432927 GCATGGAGGCGGGGCCTGGGGGG + Intergenic
1049778598 8:144417449-144417471 GCTTGGAGGCAGCCCCCAGATGG - Intergenic
1052143301 9:25016354-25016376 TCATGAAGGCAGAGCCTTCATGG + Intergenic
1053089509 9:35261800-35261822 TCATGGAGACAGAGAATAGAAGG - Intronic
1053803069 9:41776121-41776143 GCCAGGAAGCACAGCCTAGATGG - Intergenic
1054191358 9:61987431-61987453 GCCAGGAAGCACAGCCTAGATGG - Intergenic
1054461952 9:65470184-65470206 GCCAGGAAGCACAGCCTAGAGGG + Intergenic
1054647011 9:67600286-67600308 GCCAGGAAGCACAGCCTAGATGG + Intergenic
1055178280 9:73348790-73348812 GCATGGAGAAAGAGCCAATAAGG - Intergenic
1056292203 9:85155001-85155023 GCATAGGGGCAGAGCATATATGG + Intergenic
1056748206 9:89323501-89323523 GCCTGGAGGGAGAGGCAAGAAGG + Intronic
1058016849 9:100042870-100042892 TCATGGAGATAGAGCATAGAAGG + Intronic
1058046368 9:100361919-100361941 GCATAGACTCAGAACCTAGATGG + Intergenic
1058085265 9:100741313-100741335 TCATGAAGGCAGAGAGTAGAAGG - Intergenic
1058750478 9:108034260-108034282 GGATGGGGGCAGAGGGTAGAAGG - Intergenic
1058955965 9:109949061-109949083 GCATTGAGGCAGAACCTTGCAGG + Intronic
1059012542 9:110477675-110477697 TCAAGGAGGCAGAGCATACAAGG - Intronic
1060150725 9:121286526-121286548 GCATTGGGGCAGAGCCTTGGAGG - Intronic
1061420998 9:130472779-130472801 GCAGGGAGGCCGAGCCTGCAGGG + Intronic
1203761174 EBV:13469-13491 GCCTGGAGGCAGAGACTGGGCGG - Intergenic
1203762103 EBV:16541-16563 GCCTGGAGGCAGAGACTGGGCGG - Intergenic
1203763032 EBV:19613-19635 GCCTGGAGGCAGAGACTGGGCGG - Intergenic
1203763961 EBV:22685-22707 GCCTGGAGGCAGAGACTGGGCGG - Intergenic
1203764890 EBV:25757-25779 GCCTGGAGGCAGAGACTGGGCGG - Intergenic
1203765819 EBV:28829-28851 GCCTGGAGGCAGAGACTGGGCGG - Intergenic
1203766748 EBV:31901-31923 GCCTGGAGGCAGAGACTGGGCGG - Intergenic
1203767677 EBV:34973-34995 GCCTGGAGGCAGAGACTGGGCGG - Intergenic
1203567560 Un_KI270744v1:104702-104724 GAATGTAGGCAGAGGATAGAGGG - Intergenic
1185940188 X:4309342-4309364 TCATGGAGACAGAGAGTAGAAGG + Intergenic
1185967344 X:4622468-4622490 TCATGGAGACAGAGAGTAGAAGG + Intergenic
1186033712 X:5397502-5397524 GCAAAGAGGCAGAGGCTAGAGGG + Intergenic
1186226952 X:7409468-7409490 TCATGGAGACAGAGAGTAGATGG - Intergenic
1188915092 X:35900902-35900924 TCATGGAGGTAGAGAGTAGAGGG - Intergenic
1189576563 X:42359800-42359822 CCATAGAGGCAGAGACTGGAGGG - Intergenic
1189929398 X:45992147-45992169 CCATGGAGGTAGAGAGTAGAAGG - Intergenic
1190558308 X:51660681-51660703 TCATGGAGACAGAGAGTAGAAGG - Intergenic
1190903005 X:54697081-54697103 TCATGGAGATAGAGACTAGAAGG - Intergenic
1192079971 X:68038363-68038385 TCATGGAGGTAGAGAGTAGAAGG + Intergenic
1192954381 X:76052924-76052946 GCATGCAGGTGGAGCCAAGATGG - Intergenic
1194216622 X:91137083-91137105 TCATGGAGGTAGAGAGTAGAAGG + Intergenic
1194532632 X:95069808-95069830 TCATGGAGGCACTGCCTTGATGG - Intergenic
1194562899 X:95445554-95445576 TCATGGAGACAGAGAGTAGAAGG - Intergenic
1194883214 X:99280397-99280419 TCATGGAGGTAGAGAATAGAAGG + Intergenic
1195297496 X:103493611-103493633 TCATGGAGGTAGAGACTAGAAGG - Intergenic
1195819791 X:108931382-108931404 TCATGGAGACAGAGAGTAGAAGG - Intergenic
1195986274 X:110634126-110634148 TCATGGAGACAGAGTGTAGAAGG + Intergenic
1196986617 X:121280848-121280870 CCATGGAGATAGAGCGTAGAAGG + Intergenic
1197370108 X:125615300-125615322 TCATGGAGACAGAGAGTAGAAGG + Intergenic
1197440481 X:126482446-126482468 TCATGGAGACAGAGAGTAGAAGG + Intergenic
1197587049 X:128361412-128361434 TCATGGAGGTAGAGAGTAGAAGG - Intergenic
1197679463 X:129366802-129366824 TCATGGAGGCAGATCCTTCATGG - Intergenic
1198137977 X:133773292-133773314 TCATGAAGGCAGAGCCCAGGCGG + Intronic
1198430292 X:136558958-136558980 TCATGGAGACAGAGAATAGAAGG - Intergenic
1198501397 X:137251964-137251986 TCATGGAGACAGAGAATAGAAGG - Intergenic
1198717036 X:139568662-139568684 TCATGGACATAGAGCCTAGAAGG + Intergenic
1198747475 X:139904865-139904887 GCAGGCATGCAGAGCCTAGCAGG + Intronic
1199240955 X:145546702-145546724 GGTTGGAGGCAGGGCCAAGAGGG + Intergenic
1199525579 X:148788118-148788140 GCATGGAAGCTGAGCTTAGTAGG - Intronic
1199775452 X:151006956-151006978 TCATAGAGGCAGAGAGTAGAAGG - Intergenic
1199926393 X:152470054-152470076 CCATGGAGGCAGAACCCACAGGG + Intergenic
1200151712 X:153954453-153954475 GAATGCAGGCAGCGCCCAGAGGG - Exonic
1201080839 Y:10243106-10243128 GTAGGGGGGCAGAGCCAAGATGG - Intergenic
1201285345 Y:12374533-12374555 GCATGGAAGCGGACCCTAGCGGG + Intergenic
1201914163 Y:19164791-19164813 GCTTCGTGGCAAAGCCTAGAGGG - Intergenic