ID: 1158932956

View in Genome Browser
Species Human (GRCh38)
Location 18:62338974-62338996
Sequence CAGAGTTGCCACTTTGCTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 162}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158932950_1158932956 20 Left 1158932950 18:62338931-62338953 CCGAAATGAGCTGCATTCCTGGC 0: 1
1: 0
2: 2
3: 14
4: 137
Right 1158932956 18:62338974-62338996 CAGAGTTGCCACTTTGCTGTCGG 0: 1
1: 0
2: 0
3: 12
4: 162
1158932947_1158932956 24 Left 1158932947 18:62338927-62338949 CCTCCCGAAATGAGCTGCATTCC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1158932956 18:62338974-62338996 CAGAGTTGCCACTTTGCTGTCGG 0: 1
1: 0
2: 0
3: 12
4: 162
1158932953_1158932956 -5 Left 1158932953 18:62338956-62338978 CCTGCAGATTTTGCCATCCAGAG 0: 1
1: 0
2: 1
3: 11
4: 137
Right 1158932956 18:62338974-62338996 CAGAGTTGCCACTTTGCTGTCGG 0: 1
1: 0
2: 0
3: 12
4: 162
1158932948_1158932956 21 Left 1158932948 18:62338930-62338952 CCCGAAATGAGCTGCATTCCTGG 0: 1
1: 0
2: 0
3: 25
4: 226
Right 1158932956 18:62338974-62338996 CAGAGTTGCCACTTTGCTGTCGG 0: 1
1: 0
2: 0
3: 12
4: 162
1158932952_1158932956 -2 Left 1158932952 18:62338953-62338975 CCTCCTGCAGATTTTGCCATCCA 0: 1
1: 0
2: 2
3: 21
4: 192
Right 1158932956 18:62338974-62338996 CAGAGTTGCCACTTTGCTGTCGG 0: 1
1: 0
2: 0
3: 12
4: 162
1158932951_1158932956 3 Left 1158932951 18:62338948-62338970 CCTGGCCTCCTGCAGATTTTGCC 0: 1
1: 0
2: 2
3: 22
4: 240
Right 1158932956 18:62338974-62338996 CAGAGTTGCCACTTTGCTGTCGG 0: 1
1: 0
2: 0
3: 12
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158932956 Original CRISPR CAGAGTTGCCACTTTGCTGT CGG Intronic
904934046 1:34113937-34113959 CAGTGTTCCCACTTTTCAGTGGG + Intronic
905273409 1:36801730-36801752 CAGAGCTGCCACCTGCCTGTTGG - Exonic
905660057 1:39715007-39715029 AAGAGGTGCCACTCAGCTGTTGG - Intronic
909691259 1:78410028-78410050 CAGTCTGGCCACTTTTCTGTAGG - Intronic
911547367 1:99234657-99234679 CAGAATTTCCAGTTTGCTGGCGG + Intergenic
912370753 1:109172363-109172385 AAGAGTTGCCAATTTCCTTTAGG - Intronic
913433764 1:118825927-118825949 GAGGGTTGCAGCTTTGCTGTGGG + Intergenic
915723516 1:158001569-158001591 CAGAGAAGGGACTTTGCTGTGGG + Intronic
916594669 1:166232847-166232869 CAGTCTGGCCACTTTTCTGTAGG + Intergenic
919646823 1:200103510-200103532 AAGCATTGCCTCTTTGCTGTAGG - Intronic
919796515 1:201324490-201324512 CAGAGTTGCCAGATTGCAGGAGG - Exonic
921873942 1:220173073-220173095 ACGAGGTGCCACTTGGCTGTAGG + Intronic
922384841 1:225072733-225072755 CAGTCTGGCCACTTTTCTGTAGG + Intronic
922407097 1:225325857-225325879 TAGCGTTCCCACTTGGCTGTAGG + Intronic
924420488 1:243904879-243904901 CAGATTTGCCTTCTTGCTGTGGG + Intergenic
924426026 1:243951157-243951179 CAGAGTGGCCCCTGTTCTGTGGG - Intergenic
924491485 1:244542283-244542305 TAGAGTCGCCACTCAGCTGTTGG - Intronic
1068818242 10:61342869-61342891 AAGGGTTGACACATTGCTGTAGG + Intergenic
1069786451 10:70991143-70991165 AGGAGCTCCCACTTTGCTGTGGG - Intergenic
1070054602 10:72923196-72923218 CAGTCTGGCCACTTTTCTGTAGG + Intronic
1073875876 10:107920745-107920767 CAGTCTGGCCACTTTTCTGTAGG - Intergenic
1077755623 11:5024962-5024984 CAGTCTGGCCACTTTTCTGTAGG - Intergenic
1080200033 11:29658088-29658110 CAGAATTGTCACTTTCCTATTGG - Intergenic
1083741977 11:64716038-64716060 CAGGGTTGTCCCTTTGCTGAGGG - Intronic
1093138048 12:15475755-15475777 CAGAGCTGCAAGTTTGCTGGTGG - Intronic
1093388066 12:18583339-18583361 CAGTCTGGCCACTTTTCTGTAGG - Intronic
1095414457 12:41961075-41961097 CACAGTAGCCACATTGCTGGGGG - Intergenic
1097206805 12:57329153-57329175 GAGAGTTGCCACTTTTATGGAGG + Intronic
1102523318 12:113492963-113492985 CAGAATTCCCACATTGTTGTGGG + Intergenic
1103672177 12:122626820-122626842 CACATTTGCCACTGAGCTGTCGG + Intergenic
1104760353 12:131294265-131294287 CAGAGTGTCCACTTTGCTCATGG + Intergenic
1104819415 12:131666382-131666404 CAGAGTGTCCACTTTGCTCATGG - Intergenic
1104944571 12:132409869-132409891 CAGAGCTGCCACCGTCCTGTGGG + Intergenic
1107347777 13:39481353-39481375 CAAGGTTGCCACTTTCCTGGAGG + Intronic
1109272411 13:60269022-60269044 CAGAGTAGCCATTTTGCAGTAGG + Intergenic
1110867045 13:80407686-80407708 CAGCCTGGCCACTTTTCTGTAGG + Intergenic
1111235156 13:85400138-85400160 CAGTCTGGCCACTTTTCTGTAGG + Intergenic
1112579086 13:100663101-100663123 CAGAGATGCCACTGTGCAGGAGG + Exonic
1112668691 13:101609566-101609588 CAGAGATTCCCCTTTGCAGTAGG + Intronic
1114355392 14:21902487-21902509 CAGTGTTGCCACAGTGCTGATGG - Intergenic
1117820561 14:59644806-59644828 CAGTCTGGCCACTTTTCTGTAGG - Intronic
1121589256 14:95088748-95088770 CAGAGCTGACAGTTTTCTGTCGG + Exonic
1121895772 14:97645779-97645801 CAGAGGTTCCACTTTGCAGCAGG + Intergenic
1124010720 15:25836431-25836453 CAGTGTTGCCACTCTGTTGTTGG - Intronic
1124395436 15:29296538-29296560 CAGAGTTTTTACTTTGCTTTAGG - Intronic
1124631448 15:31339845-31339867 CCCAGGTGGCACTTTGCTGTGGG + Intronic
1127367676 15:58306697-58306719 CAAAGGTCCCAATTTGCTGTTGG - Intronic
1128543276 15:68551410-68551432 CAAAGTTCCCACTGGGCTGTGGG + Intergenic
1129945300 15:79534450-79534472 CTGAGATGCCACTTTGCTCTGGG - Intergenic
1130560137 15:84951618-84951640 CAGATTTGCCTCTTTCCTGCGGG + Intergenic
1131333311 15:91522940-91522962 CAGACTTGCCCCTTGGCTGCTGG + Intergenic
1132625482 16:889578-889600 GAAAGTTGCCCCTATGCTGTAGG - Intronic
1138716779 16:59032771-59032793 CAGAATTTCCAATTTTCTGTTGG - Intergenic
1139135378 16:64197653-64197675 TAAAGTTTCCACATTGCTGTGGG - Intergenic
1139877769 16:70160118-70160140 CAGGGTTGCCAGTTTTCCGTGGG + Exonic
1141902287 16:86999178-86999200 CATGGTTGTCACTGTGCTGTTGG + Intergenic
1147706037 17:42425383-42425405 AAGGGTTGCCGCTTTTCTGTGGG - Intergenic
1148408223 17:47439476-47439498 CTGAGTTTCCTCTTTGGTGTAGG + Intronic
1149085926 17:52716005-52716027 CACAGTTCCCACATTGCTGTAGG + Intergenic
1150897950 17:69235883-69235905 CAGAGTTGTAACTGTGCTGGGGG - Intronic
1154357030 18:13629409-13629431 CACAGCTGTCAGTTTGCTGTGGG - Intronic
1154454741 18:14510485-14510507 CAGTCTGGCCACTTTTCTGTGGG + Intronic
1156699954 18:39814433-39814455 CAGTCTGGCCACTTTTCTGTAGG + Intergenic
1156976578 18:43228893-43228915 CAGAGTTTCCACTATGCTCTGGG + Intergenic
1158932956 18:62338974-62338996 CAGAGTTGCCACTTTGCTGTCGG + Intronic
1161961207 19:7524219-7524241 CAGACCTGCCACTTTACAGTAGG - Intronic
1162371350 19:10281665-10281687 CAGCCTTGCTTCTTTGCTGTGGG - Intronic
1162843379 19:13372546-13372568 CAGATCTGCCACTTTCCAGTTGG + Intronic
925809684 2:7686941-7686963 CAGAGTTGCCACTTAGCCTATGG + Intergenic
926559430 2:14400082-14400104 CAGTTTTGCCTCTTTGCTGTGGG + Intergenic
927088548 2:19693265-19693287 GGGGGTTGCCAGTTTGCTGTGGG - Intergenic
930021611 2:47005068-47005090 CAGAGTTGCCAGATGGCTGCTGG - Intronic
930305039 2:49666473-49666495 CAGTTTGGCCACTTTTCTGTAGG + Intergenic
933742129 2:85542334-85542356 CAAATCTGCCACTTGGCTGTAGG - Exonic
933757592 2:85652112-85652134 CAGTGATGACACTATGCTGTTGG - Intergenic
935400115 2:102651414-102651436 CAGAGTAGCCTCTTTGCTCAAGG + Intronic
936024984 2:109024623-109024645 CTGAGGTGCCTCTTTGCTGGTGG - Intergenic
936039867 2:109141864-109141886 CAGATGTGCCAGTCTGCTGTCGG + Intronic
939119543 2:138100092-138100114 AACATTTGCCATTTTGCTGTGGG - Intergenic
940853595 2:158711430-158711452 TAGAGTTGCCACTTTTTTCTTGG + Intergenic
941891672 2:170588637-170588659 GAGAAATGCCACTTTGATGTTGG - Intronic
945509346 2:210681731-210681753 CAGTGTTGCCATTTGGCTGCTGG + Intergenic
945963417 2:216160414-216160436 CAGTGTTGAGATTTTGCTGTTGG + Intronic
946257638 2:218457618-218457640 AAGAGTTGCTATGTTGCTGTAGG + Intronic
948242593 2:236449889-236449911 ATGAGTTGCCACTTTGCTTTTGG + Intronic
948970404 2:241421307-241421329 CAGATTTCCCACCTTGCTGGGGG - Intronic
1170914060 20:20605689-20605711 CAGAGTTGTCACTGTGCGGAGGG - Intronic
1174659848 20:52202369-52202391 CAGATTTGCCTCATTGCTTTAGG + Intronic
1176819423 21:13642823-13642845 CAGTCTGGCCACTTTTCTGTGGG - Intergenic
1177133040 21:17280133-17280155 CAGAGATGCCACCTTGGAGTTGG - Intergenic
1184080087 22:42213240-42213262 CAGAGTGGCCACTCTGCAGCGGG - Exonic
1184373741 22:44098729-44098751 CAGAGTTTACACTCTGCTGCCGG + Intronic
1184990487 22:48165549-48165571 CATGGGTGCCACTTTGCTGTTGG - Intergenic
950923249 3:16716152-16716174 CAGTCTGGCCACTTTTCTGTAGG + Intergenic
950939559 3:16879607-16879629 CCCAGGTGCCACTCTGCTGTGGG - Intronic
953854684 3:46492219-46492241 GAGAGTTGCCACTTTATTGAGGG + Intergenic
954334415 3:49908008-49908030 GAGAGCTTCCACTTTGCTGCCGG - Intronic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
958890705 3:99779552-99779574 CAGAGTGGCCAGTTTTCTGGGGG + Intronic
961518566 3:127454043-127454065 CAGACTTGCCACTTTCCAGCTGG - Intergenic
961960442 3:130848971-130848993 CAGAGATGCCTCTTTATTGTGGG - Intergenic
963261588 3:143197226-143197248 CAAATTTGCCTCTTTGCTCTTGG + Intergenic
966152187 3:176877238-176877260 CAGTCTGGCCACTTTTCTGTAGG - Intergenic
966649299 3:182281441-182281463 GTGAGTTGCCACTATTCTGTGGG - Intergenic
969167023 4:5324534-5324556 CACTGTTGCCATTTTGCAGTAGG + Intronic
969468918 4:7374929-7374951 TACAGTGGACACTTTGCTGTTGG + Intronic
970641302 4:18069360-18069382 CAGACTTCCAACTTTGCTTTTGG - Intergenic
971248171 4:24949216-24949238 AAGAGATGCCACATTTCTGTGGG - Intronic
971605340 4:28651385-28651407 CAGTCTGGCCACTTTCCTGTAGG + Intergenic
972889700 4:43541818-43541840 CACATTTGCCAGGTTGCTGTAGG + Intergenic
977027131 4:91833941-91833963 CAGAGTTTCCACTGTGGTTTGGG + Intergenic
977393458 4:96443523-96443545 CACAGTTTTCACTTTACTGTGGG + Intergenic
977649561 4:99454194-99454216 CAGTCTGGCCACTTTTCTGTAGG + Intergenic
978545971 4:109873087-109873109 CAGAGTTGCCACTCTGCACCTGG + Intergenic
980021433 4:127714663-127714685 CTGAGTAGCCACTTTGATGAGGG - Intronic
982037588 4:151361674-151361696 CAGAGTAGCCAATTAACTGTAGG - Intergenic
983899052 4:173113534-173113556 CAGTCTGGCCACTTTACTGTAGG - Intergenic
983962096 4:173767473-173767495 CAGAATTGGCACTTTGTTATAGG - Intergenic
984025706 4:174540429-174540451 CAGACTTGCCTCTTTGCAGTAGG + Intergenic
985934665 5:3087655-3087677 CAGAGTTTCAATTTTGCTGAAGG + Intergenic
986644301 5:9901535-9901557 CTGAGTTTACACTTTGCTCTGGG + Intergenic
990464673 5:56060840-56060862 CAGAGTTGTCACTCTCCTGCAGG - Intergenic
991552624 5:67857727-67857749 CAGAGCTGACAGTTTTCTGTGGG - Intergenic
991688301 5:69201960-69201982 CAAATGTGCCACTTTGGTGTAGG + Intronic
992619304 5:78576544-78576566 CTGGTTTGCCACTATGCTGTAGG + Intronic
1000483098 5:161804401-161804423 CAGACTTGCCATGTCGCTGTTGG + Intergenic
1004459942 6:15826406-15826428 CAGAGGTGCCACCTTCCTTTTGG - Intergenic
1008177772 6:48289380-48289402 GAGAGTTACCCCTTTGCTCTAGG + Intergenic
1009297081 6:61965155-61965177 GAGAGTTTCCACTCTGCTCTGGG + Intronic
1009888838 6:69656268-69656290 CAGTCTTTCCACTTTTCTGTAGG - Intergenic
1010252920 6:73727092-73727114 CATAGTGTCCACTCTGCTGTGGG + Intronic
1015294134 6:131571061-131571083 CATAGTTGCCACTTTCCTTCAGG - Intergenic
1015494394 6:133865434-133865456 CAGTCTGGCCACTTTTCTGTAGG + Intergenic
1016782848 6:147979063-147979085 CAGAAATGCCACTTTGGAGTGGG + Intergenic
1017318176 6:153057031-153057053 CAGACTTGACACTGTGCTTTAGG - Intronic
1017521557 6:155207420-155207442 CAGTGTTGGCACATTGCTGGTGG + Intronic
1017648706 6:156562331-156562353 CAGAGTGGCCACGGTGCTGTCGG + Intergenic
1018566777 6:165162934-165162956 CTCAGATGACACTTTGCTGTTGG - Intergenic
1020649775 7:10860250-10860272 CAGAGTTTCATCTTTGATGTGGG - Intergenic
1021175858 7:17449303-17449325 CAGTCTGGCCACTTTTCTGTAGG + Intergenic
1021179444 7:17488791-17488813 CAGTGTTGCCACCTTTCTGGAGG - Intergenic
1021387287 7:20046519-20046541 CATAGTCTCCACTTTCCTGTTGG + Intergenic
1023624831 7:42105804-42105826 CAGAGCTGCCTCTTTGCTTGAGG - Intronic
1026306121 7:69143407-69143429 CAGGGCTCCCACATTGCTGTTGG + Intergenic
1029052155 7:97700492-97700514 CAGCCTGGCCACTTTTCTGTAGG - Intergenic
1030653582 7:112141867-112141889 CAGAGTTGCCAGATTGCAATTGG + Intronic
1032152989 7:129446139-129446161 CACAGTGGCCACTTTGCTCATGG + Intronic
1033532104 7:142274583-142274605 CAGTCTGGCCACTTTTCTGTAGG + Intergenic
1037511153 8:19584848-19584870 CAGAGTATCTACTTTGCTGTTGG - Intronic
1038459489 8:27703751-27703773 CATTGTTGCCATTTTGCTGTAGG - Intergenic
1040594926 8:48828110-48828132 CAATGATGCCACCTTGCTGTGGG - Intergenic
1041136097 8:54760988-54761010 CAGAGATGCCTGTGTGCTGTGGG - Intergenic
1041639061 8:60177305-60177327 AAGAGATGCCTCTTTACTGTGGG + Intergenic
1051877367 9:21806492-21806514 CTGAGGGGCCTCTTTGCTGTAGG + Intronic
1052378231 9:27741712-27741734 CAGTCTGGCCACTTTTCTGTAGG + Intergenic
1052812793 9:33076399-33076421 GAGAGCTGCTACTTTCCTGTGGG + Intronic
1056712203 9:89000233-89000255 CAAATGTGCCACTTTTCTGTTGG + Exonic
1057956671 9:99414714-99414736 GGGAGTTGCCTCTCTGCTGTGGG + Intergenic
1059924415 9:119193980-119194002 CAGTCTGGCCACTCTGCTGTAGG + Intronic
1060671279 9:125471754-125471776 CAGGGTTGCACCTTTGCTCTTGG - Intronic
1203527935 Un_GL000213v1:106747-106769 CAGTCTGGCCACTTTTCTGTGGG + Intergenic
1187197194 X:17099033-17099055 CAGAGTTGCCATTTTGGAGATGG - Intronic
1187211706 X:17238444-17238466 CAGAGTTGGCAATTTGGGGTAGG + Intergenic
1190087738 X:47410379-47410401 CACAGATGCCAGGTTGCTGTAGG - Exonic
1190898230 X:54641763-54641785 GAGAGTTGCCAGTTAGTTGTGGG + Intergenic
1191576916 X:62716136-62716158 CTGAGTTTCCCCTTTTCTGTGGG - Intergenic
1192316331 X:70054627-70054649 CAGAGTCCCCACTGTGCTGAGGG + Intergenic
1193861799 X:86677184-86677206 CAGAGTTGCCATTTTCATTTAGG + Intronic
1193893573 X:87082400-87082422 TAGTGTGGCCACTTTTCTGTAGG - Intergenic
1193985622 X:88237571-88237593 CAGTCTGGCCACTTTTCTGTAGG + Intergenic
1194029012 X:88789094-88789116 CAGTATGGCCACTTTTCTGTAGG + Intergenic
1195104698 X:101593087-101593109 CAGTCTGGCCACTTTTCTGTAGG + Intergenic
1197883248 X:131191306-131191328 CAGAGTTCCACCTTTCCTGTGGG - Intergenic
1198705524 X:139444024-139444046 CAGTCTGGCCACTTTTCTGTAGG - Intergenic
1199572051 X:149276046-149276068 CAGAGTTGCCAAATTCCTGCTGG - Intergenic