ID: 1158933477

View in Genome Browser
Species Human (GRCh38)
Location 18:62343622-62343644
Sequence CCATGTCCACAGTCTGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158933477 Original CRISPR CCATGTCCACAGTCTGTGCA AGG (reversed) Intronic
900786322 1:4652966-4652988 CCATAGCCACAGTGTGTGTAAGG + Intergenic
901643811 1:10706158-10706180 CCATGTCCAGAGACCGTGCAGGG + Intronic
902653080 1:17849429-17849451 CCAAGGCCCCAGCCTGTGCATGG - Intergenic
903658143 1:24961250-24961272 CCAGTGCCACAGCCTGTGCAGGG - Intronic
903740841 1:25557495-25557517 CCATGTCCCCAGTGTGTGTCTGG + Intronic
904482674 1:30804001-30804023 CCATGACCCCAATCTCTGCAGGG + Intergenic
905267779 1:36766642-36766664 CCAGGCCCACAGTCTGGTCAGGG + Intergenic
910059916 1:83078077-83078099 CCATGATCACAGTGTGTGAAAGG - Intergenic
911410225 1:97494945-97494967 CCATCTTCAGAGACTGTGCATGG + Intronic
915321427 1:155058415-155058437 CCAGGGCCACAGGCTGTGCCAGG - Exonic
923115993 1:230938422-230938444 CCATGTTCCGAGTCTGTGCGGGG - Intronic
1066592007 10:37005891-37005913 CCATCTCCTGAGTCTCTGCAAGG + Intergenic
1068213566 10:53952988-53953010 CCAGGTCCACAGTCTCAGCTGGG + Intronic
1069835005 10:71302685-71302707 CCATGTCCACAGACCTGGCAGGG - Exonic
1070844389 10:79510061-79510083 TGATGTCCACAGTCAGTGGAGGG + Intergenic
1070929408 10:80250247-80250269 TGATGTCCACAGTCAGTGGAGGG - Intergenic
1071482602 10:86076556-86076578 GCAAGTCCACAGTCTGTGAGGGG + Intronic
1073141878 10:101253742-101253764 CCATTAGCACAGTCTGAGCAGGG - Intergenic
1073854762 10:107661679-107661701 CCATTGCCTCAGGCTGTGCAGGG - Intergenic
1076502075 10:130945143-130945165 CCATGTCCTCTGGCTGTGGAAGG - Intergenic
1077154549 11:1085542-1085564 CCTTTTCCACAGTGTGTGCCGGG + Intergenic
1077334718 11:1998169-1998191 CCATGTGCAAAGTATGTGCAGGG - Intergenic
1077845159 11:6015302-6015324 CAGTGTCCCCAGGCTGTGCAGGG - Intergenic
1078530841 11:12135793-12135815 CTTTGTCCACAGTCTGGGGAGGG + Intronic
1079364228 11:19795085-19795107 CCAGTGCCACAGTCTGCGCAAGG + Intronic
1079950435 11:26795493-26795515 CCATGTTCACAGTCTGTATGGGG - Intergenic
1080643911 11:34174514-34174536 CCATGTGCACAGCCTGTGCTGGG + Intronic
1083185688 11:61016605-61016627 CCATGTCCACATTCCAGGCAAGG + Intronic
1083697403 11:64452032-64452054 CCATCTCCATAGGCTGGGCAGGG - Intergenic
1085896226 11:80642647-80642669 CCATCTCCTGAGTCTCTGCAAGG - Intergenic
1088122156 11:106382559-106382581 CCATGTCCACATTCTGGACCAGG + Intergenic
1202817701 11_KI270721v1_random:53351-53373 CCATGTGCAAAGTATGTGCAGGG - Intergenic
1093948117 12:25133878-25133900 ACTTGTCCAAAGTCTGTGAATGG - Intronic
1094351601 12:29531891-29531913 CCATGATCACAGTCTATTCATGG + Intronic
1094379890 12:29831321-29831343 CAATGTCCTGAGGCTGTGCAGGG + Intergenic
1095355027 12:41262251-41262273 CCATGACCACAATCTGTCTACGG + Intronic
1095843691 12:46722572-46722594 CCATGTGGACAATGTGTGCAGGG + Intergenic
1098644417 12:72880626-72880648 CAATGTCCCCATACTGTGCAGGG + Intergenic
1101444427 12:104727426-104727448 CCATAGCCACAGTCTGTGCTGGG - Intronic
1103922079 12:124404307-124404329 CCAGGGCCAGAGTCTGGGCAGGG + Intronic
1104903257 12:132200284-132200306 CCCTCTCCCCAGTCTGTGCAGGG - Intronic
1109164211 13:59013040-59013062 CCTGGGCCACAGTCTCTGCAAGG + Intergenic
1114272660 14:21112221-21112243 ACTTGTTCACAGTGTGTGCAAGG - Intergenic
1119259124 14:73226985-73227007 CCGTGTCCTCAGACTGTGCTTGG - Intergenic
1119487891 14:75003589-75003611 GGATGTCAACAGTTTGTGCAGGG - Exonic
1121450518 14:94004311-94004333 CCATGACCTCATCCTGTGCAGGG - Intergenic
1121883923 14:97525292-97525314 CCATGACCACAGGCAATGCAGGG + Intergenic
1122167114 14:99835110-99835132 ACCTTTCCACAGTCTGGGCACGG - Intronic
1202892400 14_KI270722v1_random:170605-170627 CCATTTCCAGAGACTGTGAATGG - Intergenic
1124530285 15:30499730-30499752 CCATTTCCTCAGGCAGTGCAGGG - Intergenic
1124768374 15:32507958-32507980 CCATTTCCTCAGGCAGTGCAGGG + Intergenic
1129438955 15:75565190-75565212 CCATTTCCACACCCTTTGCAGGG - Intronic
1129457166 15:75682211-75682233 CCATGTCCACATGATGTCCATGG + Intronic
1129726616 15:77904729-77904751 CCATGTCCACATGATGTCCATGG - Intergenic
1130076922 15:80696759-80696781 CCATGCCCCCAGTTTGTGCCTGG - Intronic
1130274650 15:82470068-82470090 CCATGTCCACATGATGTCCATGG - Intergenic
1130466996 15:84197442-84197464 CCATGTCCACATGATGTCCATGG - Intergenic
1130486611 15:84401736-84401758 CCATGTCCACATGATGTCCATGG + Intergenic
1130497268 15:84476094-84476116 CCATGTCCACATGATGTCCATGG + Intergenic
1130589294 15:85202035-85202057 CCATGTCCACATGATGTCCATGG - Intergenic
1132549625 16:548955-548977 CCATGTGCTCAGGCTGGGCAGGG - Intronic
1133187599 16:4111014-4111036 CCAGGTGCACAGTCAGTGCCAGG + Intronic
1136490459 16:30604625-30604647 GCACGCCCACAGTCTGGGCAGGG + Exonic
1138223223 16:55270713-55270735 CCTTGTACACAGTCAGTGCTAGG + Intergenic
1138375430 16:56560516-56560538 AAATGTCCACACTATGTGCATGG - Intergenic
1141517332 16:84554299-84554321 CCATGTTCACTGTCTGAGCTGGG + Intergenic
1141657082 16:85422114-85422136 CCATGTCCCCAGGGTGTGCCCGG + Intergenic
1141894747 16:86952191-86952213 CCATGCCAACAGGCTGTGCCAGG + Intergenic
1149327967 17:55551863-55551885 GCATGGCCCCTGTCTGTGCAAGG + Intergenic
1151890505 17:76948342-76948364 CGATGCCCACAGGCTGGGCAGGG - Intronic
1153993900 18:10423198-10423220 ACATGTGCAGAGTCTGTGGAGGG - Intergenic
1155433216 18:25783684-25783706 CCATGTGCAGACACTGTGCAAGG + Intergenic
1155540215 18:26862316-26862338 CCATGGCCACAGTCACTGCAGGG + Exonic
1156637960 18:39053761-39053783 CCATGGCAACAGTTTGTGAATGG - Intergenic
1157146250 18:45165637-45165659 ACATGTAGACAGTATGTGCAGGG + Intergenic
1158933477 18:62343622-62343644 CCATGTCCACAGTCTGTGCAAGG - Intronic
1161034942 19:2079354-2079376 CAATGCCCGCAGCCTGTGCATGG + Intronic
1163313959 19:16530457-16530479 CCATGTCCCCTGCCTGTGCTAGG - Intronic
1166365854 19:42278141-42278163 CATTCTCCACATTCTGTGCATGG + Intronic
1166963591 19:46514585-46514607 CCCTGCCCTCAGTCTCTGCAAGG - Intronic
925489122 2:4372528-4372550 CCATTTCCACAGTATGTTCTTGG - Intergenic
926768989 2:16351356-16351378 CCATGTCCAGAGGCTGCACAGGG - Intergenic
926900281 2:17743602-17743624 CCAAGTCCACAGTCTGTACTAGG + Intronic
934654777 2:96111720-96111742 CCATTTCCAGAGTCAGGGCAGGG + Intergenic
934747585 2:96769721-96769743 CCCATCCCACAGTCTGTGCATGG - Intronic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936687200 2:114841736-114841758 CCATGTCCCCATCCTGTGCTGGG - Intronic
936905718 2:117533815-117533837 CAATGTCCCAAGGCTGTGCAAGG - Intergenic
939824901 2:147002147-147002169 GCATGTCCCCAATCTGTGCCTGG - Intergenic
941431882 2:165423199-165423221 CATTGTCCTCAGACTGTGCAGGG + Intergenic
942139853 2:172967101-172967123 CCAGCTGCACAGTCTGGGCAGGG + Intronic
943101615 2:183493455-183493477 CCATTTCCAGAGTCTCTGAATGG + Intergenic
943481668 2:188427499-188427521 CAGTGTCCCAAGTCTGTGCAGGG - Intronic
947390429 2:229634087-229634109 TCATTTCCATAGGCTGTGCATGG - Intronic
1170756265 20:19209945-19209967 TCAGGTCCAAAGTCTCTGCAGGG + Intergenic
1170771947 20:19340580-19340602 CCATCCCCACAGCCTGGGCAGGG + Intronic
1172416731 20:34775200-34775222 CCATGACCTCAGGCTTTGCATGG - Intronic
1175740066 20:61413932-61413954 CCAAGTCCACGGTGTCTGCAGGG + Intronic
1176907686 21:14523021-14523043 CCAGGGTCACTGTCTGTGCAGGG - Intronic
1177998441 21:28131366-28131388 CCATGTCCTAAGGCTGTGCAGGG + Intergenic
1178896814 21:36565609-36565631 AGATGTCCACAGTCTGCACAGGG + Intronic
1179165656 21:38933357-38933379 CTATATCCACGGTCTGTGCAGGG + Intergenic
1181026420 22:20130333-20130355 CCATGCCCATGCTCTGTGCAGGG - Intronic
1183192786 22:36332418-36332440 CCATGACCACATTGTGTGCCTGG - Intronic
1183513845 22:38251712-38251734 CAAGGTCCACAGGCTGTGCCAGG - Intronic
1184604117 22:45562557-45562579 CCCTGGCCACTGTCTGGGCAAGG + Intronic
1184980443 22:48091739-48091761 TCATGCCCACAGTTGGTGCAGGG - Intergenic
1185099486 22:48830053-48830075 CCATGGCCAAAGCCAGTGCAAGG + Intronic
949499433 3:4665159-4665181 CCATCACCGCAGTCTGTGAATGG - Exonic
951241225 3:20288152-20288174 CAATGTCCCAAGGCTGTGCAGGG + Intergenic
954671772 3:52294832-52294854 CCATGTCCCCAGTGTGTGTGTGG + Intergenic
956291926 3:67669674-67669696 TCATCTCATCAGTCTGTGCAAGG + Intergenic
956572212 3:70709485-70709507 CCATGTCCATATGCTGTGCATGG - Intergenic
961449592 3:126996531-126996553 CCCTGTCCAGGGTCTGTGCCAGG + Intronic
964765440 3:160174393-160174415 CCATGTCTTTAGTCTGTTCATGG + Intergenic
965544791 3:169904143-169904165 CCGTGTCCAGTGTCTATGCAGGG - Intergenic
967194479 3:187014574-187014596 CTAAGTCCACATTCTGTGCTTGG + Intronic
969271517 4:6106345-6106367 CCAACTCCACAGTCCGCGCATGG - Intronic
972637223 4:40895126-40895148 CGAGGTGCCCAGTCTGTGCACGG - Intronic
973131568 4:46654188-46654210 CAATGTCCCAAGGCTGTGCAGGG + Intergenic
973609884 4:52625696-52625718 CCATGACCAAAATCTTTGCAAGG + Intronic
973708703 4:53604587-53604609 AGATGTCCAAAGGCTGTGCAGGG + Intronic
973864200 4:55095353-55095375 CCATGTCCACACTCTGTAATGGG + Intronic
975716134 4:77207268-77207290 CCATTTCCTCAGTCTGTACTAGG + Intronic
976207888 4:82639632-82639654 CCAGGTCCTCAGCCTGTGCAGGG - Intronic
979560757 4:122099198-122099220 CCTTGACCACACTCTGTACAGGG + Intergenic
979703077 4:123689527-123689549 CAATGTCCTGAGGCTGTGCAGGG + Intergenic
980992113 4:139747116-139747138 CCCTGTCCTCAGAATGTGCAGGG + Intronic
981527601 4:145721644-145721666 CCTTGTGCCCAGTCTCTGCAGGG - Intronic
981647122 4:147011876-147011898 CCATCTCCACAGTCTTAGGAAGG - Intergenic
982843348 4:160220134-160220156 CTATGTCCTGAGGCTGTGCAGGG + Intergenic
985726112 5:1516492-1516514 GCATCCCCACTGTCTGTGCATGG + Intronic
986063603 5:4214426-4214448 TTATGTCCACAGTCTGTGGGCGG - Intergenic
986605693 5:9520905-9520927 TCATGTCCATTGTCTGTGCCAGG - Intronic
987086477 5:14474309-14474331 CCATGTCGAGAGTCTGTGGAAGG + Intronic
991204808 5:64038508-64038530 CAGTGTCCAGAGCCTGTGCAGGG - Intergenic
992178478 5:74173839-74173861 ACATTTGCTCAGTCTGTGCATGG - Intergenic
995331576 5:110953179-110953201 CCATGAACACATTCTGGGCATGG + Intergenic
997481015 5:134184525-134184547 CCATGTCCACAGCGTGACCATGG + Intronic
998491035 5:142546518-142546540 CCTTGACGACAGTCAGTGCATGG - Intergenic
998546330 5:143031085-143031107 CGAAATCCACAGTCTGTGCTGGG + Intronic
998769965 5:145531651-145531673 CCATTTCCCCAGGCTCTGCAAGG + Intronic
999323672 5:150630150-150630172 CCATGCCCACAGTGACTGCAGGG - Intronic
999573668 5:152949096-152949118 ACATGTTCACTGTTTGTGCATGG - Intergenic
1001155862 5:169272040-169272062 CCATGTCAACATTCTCTGCCTGG + Intronic
1001528277 5:172444669-172444691 CCATCTCCACTGTCTGCACATGG + Intronic
1007831231 6:44639997-44640019 ACATGTCCACAGGCTGGGCGCGG - Intergenic
1011348768 6:86399978-86400000 CCATGTCCCAAGGTTGTGCAGGG + Intergenic
1014450055 6:121572087-121572109 CCATGTCCTGAGGCTGTGCAGGG - Intergenic
1015272464 6:131351281-131351303 TCATGTCAACAGTCTATGTATGG + Intergenic
1016398575 6:143653377-143653399 CCATCTCCACAGTCTGTATAAGG - Intronic
1018172046 6:161151297-161151319 CCATGTGCACAGTGCGTACAGGG + Intronic
1018908061 6:168086650-168086672 CCATGTCCACAGTGGGAACATGG - Intergenic
1021970660 7:25962665-25962687 CCAGGTCAACATTTTGTGCAAGG + Intergenic
1024055471 7:45657564-45657586 CCATGTCCACTGACTATGCCAGG + Intronic
1024122702 7:46260995-46261017 CCATGGCCACAGGGTGTGGAAGG + Intergenic
1024187825 7:46971298-46971320 CCATGTGGACAGTCTGAGTATGG + Intergenic
1024293139 7:47820911-47820933 ACGTGTCCAAAGTCTGTGAATGG + Intronic
1026455478 7:70568724-70568746 CCATGTCCACATCCTTGGCAGGG + Intronic
1035128578 7:156629834-156629856 CAGTGTCCAGAGGCTGTGCAGGG - Intergenic
1035420390 7:158724778-158724800 CCATGTCCACTCTCTGTCCTCGG - Intergenic
1035889679 8:3329747-3329769 CCATGCCATCAGTCTGTGCAGGG + Intronic
1037089674 8:14898324-14898346 CAATGTCAACAGCCTGTGCCAGG + Intronic
1038635748 8:29285822-29285844 CCGAGTTCACAGTCTGTTCAGGG - Intergenic
1038704393 8:29880333-29880355 CCATGTCCCCTGTCTGTGTTTGG + Intergenic
1040104482 8:43533864-43533886 CCATGTCCTCAGCCTGTGCTGGG + Intergenic
1040705826 8:50125902-50125924 CTATGTGTAGAGTCTGTGCAAGG + Intronic
1042816498 8:72883100-72883122 CCAGGTTCCCAGTCTCTGCAAGG + Intronic
1044578872 8:93802213-93802235 CCATCTCCACAGTCCCTTCATGG + Intronic
1046634151 8:116653899-116653921 CCATGTCTATAGGCTGTGAAAGG + Intronic
1048439842 8:134451775-134451797 CCATCTCCACATGCTGTTCAGGG - Intergenic
1049741586 8:144243514-144243536 CCTTGTCCAGAGTGTGTGCATGG + Exonic
1050535083 9:6623992-6624014 CAATGACAACAGTCTGTGAAGGG + Intronic
1050650502 9:7770919-7770941 GCATGTGCACAGTCTCTGGAAGG + Intergenic
1051164982 9:14251961-14251983 CTATGCCCACATTCTTTGCATGG + Intronic
1051485166 9:17600520-17600542 CCCTGTCTACAGTGTGTGTAGGG - Intronic
1055706689 9:79013193-79013215 CTATGGCCACAATCTATGCATGG - Intergenic
1056252979 9:84769676-84769698 CCATGACTTCAGTCTGAGCAGGG + Intronic
1056665413 9:88577363-88577385 CCGTGTCCATTGTCTGTGCAGGG - Intronic
1056965923 9:91162863-91162885 TCCTGTCCACAGCCTCTGCAAGG - Intergenic
1057800163 9:98186038-98186060 CCCTGCCCACAGGCAGTGCAGGG - Intronic
1059617590 9:115967645-115967667 CAGTGTCCAGAGGCTGTGCAGGG + Intergenic
1059901151 9:118927606-118927628 CCAAGTCCACATTCTGAACAGGG - Intergenic
1061139458 9:128755719-128755741 CCATGTCCACGCTCTGAGTAGGG + Intronic
1062186270 9:135220298-135220320 TGATGTCCACACTCTGCGCATGG + Intergenic
1062372873 9:136249208-136249230 CCATGTCCACAGTCCCTGGAGGG - Intergenic
1186922414 X:14296600-14296622 CTGTGGCCACTGTCTGTGCAGGG - Intergenic
1187304411 X:18082515-18082537 CCATGTTGCCAGTCTGTCCATGG - Intergenic
1189368773 X:40411320-40411342 ACATCTACACAGTCTGTTCATGG + Intergenic
1189805184 X:44728365-44728387 CCATTTCCAGAGTCTTTGAAAGG - Intergenic
1192842375 X:74870391-74870413 CCAGGACATCAGTCTGTGCAAGG + Intronic
1195814243 X:108867881-108867903 CAGTGTCCCAAGTCTGTGCAGGG + Intergenic
1198010928 X:132553234-132553256 CTATGTCCACAGTTTTTCCATGG + Intergenic
1198087662 X:133295810-133295832 CCATTCCCACAGCCTGTGAATGG + Intergenic
1199063506 X:143387749-143387771 CCAGTTCCACAGGCTGTACAGGG - Intergenic
1199329577 X:146543130-146543152 CCCTGTCCTGAGGCTGTGCAGGG + Intergenic
1199598095 X:149524005-149524027 CAATTTCCACAGTCTGAGAAGGG + Intronic