ID: 1158934279

View in Genome Browser
Species Human (GRCh38)
Location 18:62350204-62350226
Sequence TAAACCACACAAAAATAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 637
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 606}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158934279_1158934282 -1 Left 1158934279 18:62350204-62350226 CCCACCTATTTTTGTGTGGTTTA 0: 1
1: 0
2: 2
3: 28
4: 606
Right 1158934282 18:62350226-62350248 AATCCTCCCTGAAATCCTGTAGG 0: 1
1: 0
2: 1
3: 31
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158934279 Original CRISPR TAAACCACACAAAAATAGGT GGG (reversed) Intronic
900273468 1:1807301-1807323 AAAAACACAAAAAAATAGCTGGG + Intronic
901286303 1:8081775-8081797 TAAAATACACAAAATTAGCTGGG - Intergenic
901297649 1:8172959-8172981 AAAAACACACAAAAATTGGCTGG - Intergenic
901403016 1:9027192-9027214 AAAAACACACAAAAAAAGGCTGG - Intergenic
902420079 1:16271992-16272014 AAAACAATACAAAAATAGCTGGG + Intronic
903586580 1:24420114-24420136 TAAAATACATAAAAATAGGGAGG + Intronic
904191538 1:28747965-28747987 TAAACTACAAAAAATTAGCTGGG + Intronic
904630798 1:31840673-31840695 TAAAATACAAAAAAATAGCTGGG + Intergenic
905100815 1:35520552-35520574 TAAAACATAAAAAAATAGCTGGG - Intronic
905118807 1:35665835-35665857 TAAAACACAAAAAATTAGTTGGG - Intergenic
905161869 1:36043429-36043451 TTAACCAAACAAATCTAGGTTGG + Exonic
905486468 1:38300700-38300722 TAAACAACTCAAACATAAGTTGG + Intergenic
906029514 1:42706953-42706975 TAAAAAACACAAAATTAGCTGGG - Intergenic
906365937 1:45209703-45209725 TTAACCAGACAGAAATATGTAGG + Intronic
906389037 1:45397903-45397925 TAAAAAACACAAAAAGAGTTAGG - Intronic
906625902 1:47325346-47325368 TAAAACACAAAAAATTAGCTGGG + Intergenic
907199384 1:52713272-52713294 AAAACCACAAAAAACTAGCTAGG + Intergenic
907463881 1:54622576-54622598 AAAACCACAAAAAATTAGCTGGG + Intronic
907833993 1:58092173-58092195 AAAAATACAAAAAAATAGGTGGG + Intronic
908437127 1:64118041-64118063 AAAAACACACAAAAATTGCTGGG + Intronic
910511297 1:88008364-88008386 TAAGACAAACAAAAATGGGTTGG + Intergenic
910930522 1:92438836-92438858 TAAATCACCCAAAATGAGGTTGG + Intergenic
911108136 1:94153889-94153911 TAAAACACAAAAAATTAGCTGGG - Intronic
912248668 1:107988453-107988475 TAAAACACAAAAAATTAGCTGGG - Intergenic
912904368 1:113688333-113688355 TAAAATACAAAAAAATAGCTGGG + Intergenic
915422513 1:155795385-155795407 TATACTACACAAAATTAGCTGGG - Intronic
915844460 1:159249251-159249273 TAAAACTCACAAAAGTATGTGGG - Intergenic
916227364 1:162502013-162502035 TAAACCTCAAAAAATTAGCTGGG + Intronic
916776178 1:167966828-167966850 TAAACCTCAGCAAAATAGGGAGG - Intronic
917757982 1:178122256-178122278 TACACCAGACAAAAACAGATCGG - Intronic
918215261 1:182387943-182387965 TAAACTACCCTAAACTAGGTAGG + Intronic
918390830 1:184059729-184059751 TAAAACACAAAAAATTAGTTGGG - Intronic
918628382 1:186684837-186684859 GACAACACACAAGAATAGGTTGG + Intergenic
920109888 1:203580372-203580394 AAAACAAAACAAAAATAGCTGGG - Intergenic
920655882 1:207874442-207874464 AAAACCACAAAAAATTAGCTGGG + Intergenic
920900880 1:210109415-210109437 TAAAACACAAAAAATTAGCTGGG + Intronic
921196417 1:212761476-212761498 CAAAAAACACAAAAATAGCTGGG + Intronic
921441536 1:215191986-215192008 TAAGCCAGAGACAAATAGGTAGG + Intronic
922126207 1:222726554-222726576 TAAAACATACAAAATTAGCTGGG + Intronic
922192995 1:223336112-223336134 TAAAAAACACAAAATTAGCTGGG - Intronic
922488172 1:225992860-225992882 TCAAAAACACAAAAAAAGGTGGG + Intronic
923360792 1:233208637-233208659 CACAGCACACAAAAATAGATTGG + Exonic
924393293 1:243587449-243587471 AAAAGCACACAAAAATAGCTGGG + Intronic
924942174 1:248819540-248819562 TAAAATACAAAAAAATAGCTGGG + Intronic
1063093488 10:2889351-2889373 TAAAACACAAAAAATTAGCTGGG - Intergenic
1063146088 10:3296474-3296496 TAAAATACAAAAAAATAGCTGGG - Intergenic
1063231862 10:4073171-4073193 AAGACCACATAAAAATATGTAGG + Intergenic
1063593724 10:7413684-7413706 AAAGCAACACAAAAATAGGAGGG - Intergenic
1063811101 10:9708662-9708684 TAAACCACTTAAACATAAGTAGG - Intergenic
1064188421 10:13184152-13184174 CAAAAAACACAAAAATAGGCTGG - Intronic
1064262791 10:13799316-13799338 TAAAATACAAAAAAATAGCTGGG - Intronic
1064275644 10:13902677-13902699 TAAAACACAAAAAAATAGCTGGG + Intronic
1064399297 10:15007859-15007881 TCACCCACACAAAAAAAGGATGG + Intergenic
1064512636 10:16111969-16111991 TAAGCCACACCAAAATATTTTGG - Intergenic
1065116216 10:22485652-22485674 AAAACAAAACAAAAAAAGGTGGG - Intergenic
1065875783 10:29996135-29996157 AAAAACACACAAAATTAGCTGGG + Intergenic
1065901978 10:30216178-30216200 TAAACACCACAAAAATATTTTGG - Intergenic
1066311553 10:34202069-34202091 TAAAAAAAACAAAAATAGGCTGG - Intronic
1066601023 10:37107162-37107184 TAAACAATACATAAATAAGTGGG + Intergenic
1068147013 10:53084661-53084683 GAAACCACACAAAAATAGTGGGG - Intergenic
1068430943 10:56931506-56931528 TATACCTCACAACAATAGGGTGG - Intergenic
1069008064 10:63340077-63340099 TAAATTACACATATATAGGTTGG + Intronic
1069742607 10:70695062-70695084 CAAACCACAAAGAAATAGGATGG - Intronic
1070906788 10:80079855-80079877 AAAAACACAAAAAAATAGCTGGG - Intronic
1070997981 10:80802976-80802998 TAAAACATACAAAATTAGCTGGG + Intergenic
1072235512 10:93450095-93450117 TAAAAAACACAAAAATAGGCCGG + Intronic
1072362402 10:94672646-94672668 CACACCATACAAAAATAAGTAGG + Intergenic
1072825607 10:98603299-98603321 TAAAACTCACAAAAATATGGGGG - Intronic
1072866277 10:99065727-99065749 TTAACCAGACAAAAGTGGGTGGG + Intronic
1073173702 10:101536354-101536376 TAACTCACACAGAAATATGTAGG - Intronic
1074120401 10:110489927-110489949 TAAACAATACAAAATTAGCTGGG - Intergenic
1074163186 10:110851195-110851217 TCAACCACACAAAAACCGCTGGG - Intergenic
1074731197 10:116377489-116377511 GGAATCACAAAAAAATAGGTTGG - Intronic
1078334613 11:10453747-10453769 TAAAACACAAAAAATTAGCTGGG - Intronic
1078574209 11:12484973-12484995 CAAAACACACAAAAATTAGTTGG - Intronic
1080448526 11:32359155-32359177 TTAACCACACAATAATTTGTGGG - Intergenic
1081271788 11:41093946-41093968 AAAAACACACAAAAATAGCCAGG + Intronic
1082013366 11:47466063-47466085 AAAAACACACAAAAAAAGGAAGG + Intronic
1084138530 11:67206574-67206596 TAAAATACAAAAAATTAGGTGGG + Intronic
1084819692 11:71677299-71677321 TAAAATAAACAAAAATAGGGCGG + Intergenic
1087033024 11:93725092-93725114 TAAAAAACACAAAAATTAGTTGG + Intronic
1087570691 11:99923950-99923972 TAAAACACAAAAAATTAGCTGGG - Intronic
1088439930 11:109858842-109858864 TAAAACAGAAAAAAAAAGGTAGG + Intergenic
1090119203 11:124006716-124006738 TAAACAACAAAAAAATATTTGGG + Intergenic
1091878104 12:3953934-3953956 CAAACCAAACAAAAATAAGGTGG - Intergenic
1093918796 12:24836215-24836237 TGAACCAGACAAAAGTTGGTGGG + Intronic
1094532444 12:31289629-31289651 TAAACCTCATAAACACAGGTGGG + Intronic
1094546018 12:31405375-31405397 AAAACTACAAAAAAATAGCTGGG - Intronic
1094697548 12:32835347-32835369 TAAACTACCCAAAAGTAGGCCGG - Intronic
1095728518 12:45478151-45478173 TAAAACACAAAAAGTTAGGTGGG + Intergenic
1095907708 12:47394659-47394681 AAAACTACAAAAAAATAGCTAGG + Intergenic
1096293349 12:50361493-50361515 TAAAACACACACACATAGGCCGG - Intronic
1096378447 12:51134443-51134465 AAAAATACAAAAAAATAGGTGGG - Intronic
1097112216 12:56669168-56669190 AAAACTACAAAAAAATAGCTAGG - Intronic
1097482098 12:60141247-60141269 AAAACCCCACAAAAATATGGAGG + Intergenic
1097713996 12:62945893-62945915 TAAAGCACAAATAAATAGGTGGG + Intergenic
1098953863 12:76668815-76668837 AAAACAAAACAAAAAAAGGTTGG - Intergenic
1099259568 12:80360640-80360662 TAAAACACAAAAAATTAGCTGGG - Intronic
1100000523 12:89829557-89829579 TAAATGACACAAAGATTGGTGGG + Intergenic
1100249392 12:92801110-92801132 TTAACCACAGAAAAATATTTTGG + Intronic
1100477991 12:94951699-94951721 TGAACCACACCAACTTAGGTTGG - Intronic
1100618559 12:96250142-96250164 TAAACCACGCAAAACTAAGGGGG + Intronic
1100662024 12:96709879-96709901 AAAACCACAAAAAATTAGCTGGG - Intronic
1100681785 12:96931970-96931992 TAAACTTTACAAAAATAAGTTGG - Intronic
1100834733 12:98555563-98555585 TAAAACACAAAAAACTAGCTGGG - Intergenic
1101209402 12:102521141-102521163 TAAAACACAAAAAATTAGCTGGG + Intergenic
1101269402 12:103127855-103127877 TAAACCACATAAAAATATAAAGG - Intergenic
1101673990 12:106901038-106901060 AAAACAACAAACAAATAGGTAGG + Intergenic
1102279009 12:111603747-111603769 AAAAATACAAAAAAATAGGTGGG + Intergenic
1103324756 12:120113049-120113071 TAAAACACAAAAAATTAGTTGGG - Intronic
1103773587 12:123348459-123348481 TAAAACACAAAAAATTAGCTGGG + Intronic
1103865801 12:124051066-124051088 CAAAAAACACAAAAATAGGCTGG + Intronic
1104574526 12:129954944-129954966 AAAACTACACAAAGATAGGCTGG - Intergenic
1105464050 13:20620724-20620746 TAAACCACAAAAAATTAGCCAGG - Intronic
1106024328 13:25942581-25942603 TAAAACACAAAAAATTAGCTGGG - Intronic
1106167064 13:27257103-27257125 TAAAACATACAAAAATAAGTGGG + Intergenic
1106951892 13:34893602-34893624 TAATCCACAGAAAAATAGAAAGG - Intergenic
1107297807 13:38931247-38931269 TAAAACACAAAAAATTAGCTGGG + Intergenic
1107536955 13:41344709-41344731 TTACCAAAACAAAAATAGGTGGG - Intronic
1107777344 13:43859809-43859831 AAAAGCACATAAAAATAGTTTGG - Exonic
1108401971 13:50054452-50054474 GAAACAACACAAAAATTGGCCGG - Intergenic
1108508469 13:51134369-51134391 CAAACCACACCAAAACAGCTTGG - Intergenic
1109472143 13:62822442-62822464 TAATCTACACATAAATATGTTGG - Intergenic
1109527592 13:63597002-63597024 TAAAACACAAAAAATTAGCTGGG - Intergenic
1110421732 13:75317765-75317787 TATACCAGTCAAAAATGGGTGGG - Intronic
1110442437 13:75540129-75540151 TAAAATACAAAAAAATAGCTGGG - Intronic
1110598345 13:77342834-77342856 AAAAGGACACAAAAATAGGCTGG - Intergenic
1110653269 13:77967244-77967266 TAAAGAAGACAAAAAAAGGTTGG - Intergenic
1110783546 13:79495553-79495575 TACACCACACAAAAATATTTAGG - Intronic
1111316281 13:86565021-86565043 CAAAACACACAAAAATTAGTGGG - Intergenic
1111853731 13:93609373-93609395 AAAACAAAACAAAAATAGCTGGG - Intronic
1111885610 13:94017182-94017204 TTAACCACACAAAAATGTGTTGG - Intronic
1111895838 13:94140528-94140550 TAATCCTCACAAAAATAGCTGGG + Intronic
1112516949 13:100061722-100061744 AAAAACAAAGAAAAATAGGTGGG - Intergenic
1113112920 13:106843654-106843676 TAAATCACATAAAAATATGAAGG + Intergenic
1113125068 13:106969000-106969022 AAAAACACAAAAAATTAGGTGGG - Intergenic
1113199720 13:107853772-107853794 TAAAACACACAAAAATAGATTGG + Intronic
1113491731 13:110697601-110697623 TAAAACACAAAAAATTAGCTGGG - Intronic
1114223847 14:20721177-20721199 AAAAACACAAAAAATTAGGTGGG - Intergenic
1114715872 14:24823836-24823858 TAACAAACACAAAAATTGGTAGG + Intronic
1115003089 14:28444478-28444500 AAAACCTCACATAAATAGTTAGG + Intergenic
1116143702 14:41036042-41036064 TATCGCACACAAAAAAAGGTAGG + Intergenic
1116242082 14:42356843-42356865 TAAAACACACAAGAAAATGTAGG + Intergenic
1116840049 14:49810827-49810849 CAAAAAACACAAAAATAAGTTGG + Intronic
1117909461 14:60622933-60622955 CAAACCACGCAAAACTTGGTAGG + Intergenic
1118286681 14:64480800-64480822 TAAAACACAAAAAATTAGCTGGG - Exonic
1118646748 14:67847889-67847911 ACAACCACACAAAAATGGGGGGG - Intronic
1119701394 14:76757830-76757852 AAAACTACAAAAAAATAGCTGGG - Intergenic
1120540513 14:85744854-85744876 TCAACCATAAAAAAAAAGGTGGG + Intergenic
1121239558 14:92418996-92419018 TAAAGAACACAAAAATTGGCCGG - Intronic
1122181345 14:99957088-99957110 TAAAACACAACAAAATAGGCCGG - Intergenic
1122949829 14:105036756-105036778 TAAATTACACAAAAATTGGCTGG - Intergenic
1123507433 15:20958261-20958283 AAAAACACACAAAAAAAGGAAGG - Intergenic
1123564659 15:21532003-21532025 AAAAACACACAAAAAAAGGAAGG - Intergenic
1123600913 15:21969293-21969315 AAAAACACACAAAAAAAGGAAGG - Intergenic
1123830640 15:24132737-24132759 TAAAATACAAAAAAATAGCTGGG + Intergenic
1123855765 15:24409582-24409604 TAAAATACAAAAAAATAGCTGGG + Intergenic
1123864303 15:24501769-24501791 TAAAATACAAAAAAATAGCTGGG + Intergenic
1124158078 15:27245710-27245732 AAAACCACAAAAAATTAGCTGGG + Intronic
1125101262 15:35915298-35915320 TAAAACACACCAAAACAGATAGG - Intergenic
1125140472 15:36400423-36400445 TAAACTAAAAAAAAAAAGGTTGG + Intergenic
1125658240 15:41375815-41375837 TGAACCACACAAAGGTATGTGGG + Exonic
1125688246 15:41576487-41576509 TAAAAAATACAAAAATTGGTTGG - Intronic
1125701374 15:41688234-41688256 TAAAATACAAAAAATTAGGTTGG - Intronic
1125926870 15:43569992-43570014 TAAACCAGAAAAAAATGGTTGGG + Intronic
1125940014 15:43669557-43669579 TAAACCAGAAAAAAATGGTTGGG + Intergenic
1126039878 15:44579371-44579393 ACAAACACACAAAAATAGCTGGG + Intronic
1126196206 15:45935056-45935078 TAAACTACAAAAAATTAGCTGGG - Intergenic
1126601100 15:50428275-50428297 TAAAACACAAAAAATTAGCTGGG - Intronic
1126624364 15:50672034-50672056 CCAACCAAACAAAAATAGGTAGG - Intronic
1127089060 15:55448707-55448729 AAAACTACACAAAATTAGCTGGG + Intronic
1127208392 15:56744624-56744646 AAAATCACACAAAACTAGGCTGG - Intronic
1127443854 15:59039875-59039897 TAAAACACAAAAAATTAGCTGGG - Intronic
1127526492 15:59797754-59797776 TAAAACAAACAAAAATAGCTAGG + Intergenic
1127674004 15:61223151-61223173 TAAAACACAAAAAATTAGCTGGG + Intronic
1127956234 15:63856259-63856281 TAAAAAACACAAAAATGGCTAGG - Intergenic
1128175738 15:65554164-65554186 TAGAGCAGACAAAAATTGGTGGG - Intronic
1129881537 15:79009883-79009905 TAAAACACAAAAAATTAGCTGGG - Intronic
1130215568 15:81965541-81965563 AAAAACACAAAAAATTAGGTGGG + Intergenic
1130622640 15:85479577-85479599 AAATCCACAAAAAAATAGGAGGG - Intronic
1131088228 15:89596738-89596760 TAAACCCCAAAAATAAAGGTAGG - Intronic
1131738731 15:95363145-95363167 AAAACCAAACAAAAATAGGTGGG - Intergenic
1131759672 15:95608010-95608032 CTAACCACACAGAAATATGTAGG + Intergenic
1132301427 15:100778589-100778611 TACGTCACACAAAAATTGGTTGG + Intergenic
1202973021 15_KI270727v1_random:259113-259135 AAAAACACACAAAAAAAGGAAGG - Intergenic
1133093964 16:3428217-3428239 AAAACCCCACAAAATTAGCTGGG + Intronic
1133631045 16:7622060-7622082 CAGACCATACAAAAATAGGTGGG + Intronic
1133794373 16:9034038-9034060 TAAAATACAAAAAAATAGCTGGG - Intergenic
1134351617 16:13442945-13442967 CACACCAAATAAAAATAGGTTGG + Intergenic
1134398146 16:13884494-13884516 TAAAACACAGAAAATTAGTTGGG - Intergenic
1135168641 16:20163870-20163892 TAAAACACAAAAAAATAGCCAGG - Intergenic
1136176609 16:28521492-28521514 CAAACTACCCTAAAATAGGTGGG + Intergenic
1136562375 16:31047673-31047695 AAAACAAAACAAAAATAGGCTGG - Intergenic
1137738107 16:50740075-50740097 GAAAGGACACAAAAATAGGCCGG + Intergenic
1138232145 16:55346139-55346161 CAAAAAACACAAAAATTGGTTGG - Intergenic
1139110142 16:63880526-63880548 TAAACCACACATAAACAGAGTGG + Intergenic
1139519629 16:67473507-67473529 AAAACCACAAAAAATTAGTTGGG - Intronic
1139766114 16:69231426-69231448 TAAAACATACAAAATTAGCTGGG + Intronic
1139941054 16:70605829-70605851 AAAAACACAAAAAATTAGGTGGG - Intronic
1140047361 16:71450556-71450578 TAAACCACAAAAAATTAGCCGGG + Intronic
1140083827 16:71776807-71776829 TAAACTATACAAAAAAAGGCAGG + Intronic
1140341195 16:74164863-74164885 AGAAACACACAAAAATAGGATGG + Intergenic
1141414265 16:83857915-83857937 CAACCCCCACAAAAATAGGATGG - Intergenic
1141561947 16:84875079-84875101 AAAAACACACAAAATTAGCTGGG + Intronic
1141973613 16:87498917-87498939 TATACGACACAAAAATAGGATGG + Intergenic
1142903943 17:3030614-3030636 TAAAACAGAGAAAAATAAGTAGG + Intronic
1142981547 17:3675198-3675220 TAAAATACAAAAAAATAGCTGGG - Intronic
1143320014 17:6062146-6062168 TAAACCACATAAAAACACCTAGG + Intronic
1143728053 17:8863693-8863715 TAAAATACACAAAATTAGCTGGG - Intronic
1144263071 17:13542164-13542186 TAAAAAATACAAAAATAGCTGGG + Intronic
1144408482 17:14975701-14975723 TAAACCACAGAGAAATTGGCTGG + Intergenic
1145843921 17:28021308-28021330 TAAAACACAAAAAATTAGCTGGG - Intergenic
1146214020 17:30964226-30964248 TAAAACACAAAAAATTAGCTGGG + Intergenic
1146244570 17:31268464-31268486 TAAAACACAAAAAATTAGGCAGG + Intronic
1147007903 17:37419327-37419349 AAAACCCCACAAAATTAGGCAGG - Intronic
1147344899 17:39783947-39783969 CAAAACAAAAAAAAATAGGTTGG + Intronic
1147946956 17:44085796-44085818 TAAAAAATAAAAAAATAGGTTGG - Intronic
1147992257 17:44341790-44341812 AAAACCACACAAAAATTAGCTGG + Intergenic
1148362332 17:47022329-47022351 CAAAACATACAAAATTAGGTGGG - Intronic
1148657104 17:49293991-49294013 TAAAACACAGAATGATAGGTCGG - Intronic
1149748009 17:59118103-59118125 AAAACCACAAAAAATTAGCTGGG + Intronic
1149791964 17:59486116-59486138 CAAACAACAGAAAAATAAGTTGG - Intergenic
1150793323 17:68217971-68217993 AAAAATACACAAAATTAGGTGGG - Intergenic
1152156966 17:78640763-78640785 TAAACCAAAAAAAATTAGCTTGG + Intergenic
1152437325 17:80284381-80284403 AAAACAAAACAAAAATAGCTGGG + Intronic
1153055361 18:940465-940487 TCACACACACAAAAATAGTTTGG - Intergenic
1153402306 18:4694526-4694548 AAAAACAAACATAAATAGGTGGG + Intergenic
1153763543 18:8354050-8354072 AAAACCACAAAAAATTAGCTGGG + Intronic
1155267527 18:24107919-24107941 AAAAACACAAAAAATTAGGTGGG - Intronic
1155352482 18:24920066-24920088 AAAACCCCACAAAATTAGCTGGG + Intergenic
1155994356 18:32314001-32314023 TATACCACATAGAAATATGTAGG + Intronic
1156091499 18:33477665-33477687 AAAAAAACACAAAAATTGGTTGG - Intergenic
1156887407 18:42151379-42151401 TGACCCAGACTAAAATAGGTAGG - Intergenic
1157761570 18:50269144-50269166 TAAATGACACAAAAATAGCCAGG + Exonic
1157955448 18:52092190-52092212 TAAAAAACACAAAAATATATGGG + Intergenic
1158073301 18:53498880-53498902 TAAATCACAGAAAAATTGGCTGG + Intronic
1158437671 18:57444853-57444875 CAAACCAAACAAAAATGGGAAGG + Intronic
1158934279 18:62350204-62350226 TAAACCACACAAAAATAGGTGGG - Intronic
1159514392 18:69438909-69438931 AAAACTACAAAAAAATAGCTGGG + Intronic
1159729249 18:72004509-72004531 TAAAACAAAAAAAAATAGGCTGG - Intergenic
1159819615 18:73123449-73123471 AAAAACACAAAAAAATAGCTGGG + Intergenic
1160214937 18:76920388-76920410 TAAAAAATACAAAATTAGGTGGG + Intronic
1161121527 19:2529512-2529534 TCAACAACACAAAAATGGGCCGG - Intronic
1161784373 19:6314307-6314329 TAAAATACAAAAAAATAGCTGGG + Intronic
1162008630 19:7797081-7797103 AAAACTACACAAAATTAGCTGGG - Intergenic
1162529135 19:11225529-11225551 ACACACACACAAAAATAGGTGGG + Intronic
1163379413 19:16955132-16955154 ACAAACACACAAAAATAGCTGGG + Intronic
1163448936 19:17364244-17364266 TAAAACACAAAAAATTAGCTGGG - Intronic
1163937029 19:20456304-20456326 TAAAACAAACAAAAATAGCTGGG - Intergenic
1164396527 19:27868894-27868916 TAAAAAACACAAAATTAGCTGGG - Intergenic
1164623852 19:29714200-29714222 TAAAAAATACAAAAATTGGTCGG + Intronic
1164871636 19:31650384-31650406 TCAACCAGAAAAAAATGGGTTGG - Intergenic
1164998610 19:32742315-32742337 AAAACTACAAAAAATTAGGTGGG - Intronic
1165480707 19:36062105-36062127 TAAAACACAAAAAACTAGCTGGG - Intronic
1165647025 19:37449004-37449026 TACAGCACACCAAAATATGTGGG - Intronic
1165919180 19:39282693-39282715 TAAAACACAAAAAATTAGCTGGG + Intergenic
1165962130 19:39543861-39543883 TAAAAAATACAAAAATAAGTTGG + Intergenic
1166167339 19:41000876-41000898 TAAAAAACACAAAACTAGCTGGG + Intronic
1166312807 19:41972602-41972624 TAAAACACAAAAAATTAGCTGGG + Intronic
1166515215 19:43441447-43441469 TAAAAGAAACAAAAATTGGTTGG + Intergenic
1166707473 19:44915974-44915996 AAAACAAAACAAAAATAGCTGGG + Intronic
1167122055 19:47523187-47523209 AAAAACACAAAAAAATAGCTGGG - Intronic
1167217212 19:48172467-48172489 AAAACCACACAAAAATTAGCCGG - Intronic
1168483316 19:56739745-56739767 TAAAATACAAAAAATTAGGTGGG - Intergenic
1202641567 1_KI270706v1_random:95383-95405 TTAACCAAACAAAGAAAGGTTGG - Intergenic
925198134 2:1944356-1944378 TATACTACAAAAAAATAGGTGGG + Intronic
925246447 2:2387778-2387800 TCAACCAAACAAACAAAGGTGGG - Intergenic
925650635 2:6085844-6085866 CAAAACACAAAAAAATAGCTGGG - Intergenic
925692914 2:6543344-6543366 AAAAACACAAAAAAATAGCTGGG - Intergenic
926348619 2:11974266-11974288 TAAAATACAAAAAAATAGCTTGG - Intergenic
926691354 2:15736417-15736439 TAAAACACAAAAAATTAGCTGGG - Intronic
926852842 2:17219927-17219949 TAAATCACACCATAATAAGTCGG - Intergenic
927315181 2:21673581-21673603 CAAACCACACAAATATCTGTGGG - Intergenic
928476961 2:31637391-31637413 GAAGCCAGACAAAAACAGGTAGG + Intergenic
928595210 2:32853462-32853484 TAAAACACAAAAAATTAGCTGGG + Intergenic
928963791 2:36956961-36956983 AAAGCAACACAAAAATAGGAAGG + Intronic
929163370 2:38855936-38855958 AAAAACACACAAAAATTAGTTGG + Intronic
929210829 2:39355198-39355220 TAAAACACAAAAAATTAGCTGGG + Intronic
930179377 2:48337458-48337480 AAAACCCCACAAAAATTAGTGGG - Intronic
931329666 2:61267601-61267623 AAAACCACAAAAAATTAGCTGGG - Intronic
932382199 2:71294977-71294999 TGAAAAACACAAAAATAAGTTGG - Intronic
932539277 2:72635031-72635053 TAAACCAAACCAAAATTAGTAGG + Intronic
932597586 2:73103698-73103720 CAAACCACACAGAAAGATGTGGG + Intronic
932938105 2:76130183-76130205 AAAACCAAACAAAAAGAGGGAGG - Intergenic
933387039 2:81624070-81624092 TAAACCACACACATATAAGATGG - Intergenic
933391028 2:81666817-81666839 GGAACCACACAAATATAGATGGG - Intergenic
934669755 2:96203803-96203825 ATAAACACACAAAATTAGGTGGG + Intronic
935519102 2:104082042-104082064 TAAAACACACAAAAATGTGAGGG + Intergenic
937609518 2:123843161-123843183 AAAACCACACAACAATAGTGGGG + Intergenic
938500895 2:131830928-131830950 TCAACCACCCAAAAATACTTGGG - Intergenic
938814115 2:134882117-134882139 CAAAACAAACAAAAAAAGGTGGG + Intronic
938874267 2:135516904-135516926 TACACCAATCAAAAATAGTTTGG + Intronic
938923342 2:136015493-136015515 TAAACCAAACAAAACTGAGTTGG + Intergenic
939880573 2:147626105-147626127 TCAACAACAAAAAAATATGTGGG + Intergenic
940061486 2:149575223-149575245 CAAACCACAGAAAAAAATGTGGG + Intronic
940134742 2:150423505-150423527 TTAAACTAACAAAAATAGGTAGG - Intergenic
940309464 2:152262189-152262211 TAAAACACAAAAAATTAGCTGGG - Intergenic
940400587 2:153244096-153244118 TAAACTCCACAAAAATTGGGGGG + Intergenic
940480760 2:154227722-154227744 CTAATCACACAAAAATAGGCTGG + Intronic
941013826 2:160332098-160332120 TAAACTAAACAAAAATAATTAGG - Intronic
942262688 2:174185407-174185429 TAATCACCACTAAAATAGGTAGG + Intronic
942656478 2:178219258-178219280 TAAACCACACAACAACATTTTGG + Intronic
942917727 2:181331879-181331901 TAAAACATATAAAAGTAGGTGGG + Intergenic
943097342 2:183446046-183446068 TAAAACACAAAAAATTAGCTGGG + Intergenic
944664189 2:201945950-201945972 TAAAACACAAAAAATTAGCTGGG - Intergenic
944807086 2:203293374-203293396 AAAACTACACAAAATTAGCTGGG - Intronic
945598621 2:211829130-211829152 TAAAGCACACACAAAAAGCTAGG + Intronic
946199325 2:218062548-218062570 TAAACTACAAAAAATTAGCTGGG + Intronic
946951790 2:224884237-224884259 TAAACCATCCAGAAATAGGCCGG + Intronic
948436864 2:237959724-237959746 GAAACCACAAAAAATTAGCTGGG + Intergenic
1168882909 20:1223329-1223351 AAAAACACACAAAATTAGGTGGG + Intergenic
1169294824 20:4385809-4385831 TAAAATACAAAAAAATAGCTGGG + Intergenic
1169451158 20:5712432-5712454 TATACAAAACAAAAATAGGCGGG - Intergenic
1169831694 20:9832431-9832453 TAAAATACAAAAAAATAGCTGGG - Intronic
1170396625 20:15932447-15932469 TAACCCACATGAATATAGGTTGG + Intronic
1170878196 20:20270829-20270851 AAAAACACACAAAAATTAGTTGG - Intronic
1171022731 20:21601355-21601377 TAAACCACTCAAAAATTTGGTGG - Intergenic
1171082984 20:22207441-22207463 CAAACCCCATAACAATAGGTGGG - Intergenic
1171204095 20:23265913-23265935 TAAAACATACAAAAATAGCCGGG - Intergenic
1171402254 20:24881863-24881885 TAAAACACCCACACATAGGTGGG + Intergenic
1172373325 20:34414625-34414647 AAAACCCCACAAAATTAGCTGGG - Intronic
1172541202 20:35718513-35718535 TAAAACACAAAAAAGTAGGTTGG + Intronic
1172740823 20:37165557-37165579 AAAACCGCACAAAATTAGCTGGG + Intronic
1173665391 20:44759417-44759439 TAAAAAACACAAAAATTGGCCGG - Intronic
1173679777 20:44869857-44869879 AAAACCACAAAAAATTAGCTGGG + Intergenic
1173803102 20:45907164-45907186 TAAAACACAAAAAACTAGTTGGG + Intronic
1174208385 20:48857773-48857795 AAAACAAAACAAAAAAAGGTAGG + Intergenic
1174325543 20:49775785-49775807 TAAACAACTCAAAAATGTGTAGG - Intergenic
1174499875 20:50976533-50976555 TAAAACACAAAAAATTAGCTGGG + Intergenic
1176648994 21:9528902-9528924 AAAACAACAGAAAAATAGTTTGG - Intergenic
1176888067 21:14280837-14280859 AAAACCATACAATAAAAGGTGGG + Intergenic
1177003748 21:15645516-15645538 TAAAATACAAAAAAATAGCTGGG - Intergenic
1177555974 21:22689276-22689298 TAAAATACAAAAAATTAGGTGGG - Intergenic
1177710087 21:24762793-24762815 CAAAACACACAAAATTAGGTAGG - Intergenic
1178186680 21:30229949-30229971 GAAACCACAGAAATATAGATGGG + Intergenic
1179327405 21:40361456-40361478 TAAAACACAAAAAATTAGCTGGG + Intronic
1180360379 22:11886492-11886514 TTAACCAAACAAAGAAAGGTTGG + Intergenic
1181318385 22:21985897-21985919 AAAACTACAAAAAATTAGGTGGG + Intergenic
1182245545 22:28954774-28954796 TAAAACATACAAAAATTAGTTGG - Intronic
1182309402 22:29393971-29393993 TAAAACAAATAAAAATAGGCCGG - Intronic
1182384538 22:29925752-29925774 AAAATCACAAAAAAATAGCTGGG + Intronic
1184842499 22:47060589-47060611 AAAAACACAAAAAATTAGGTGGG - Intronic
949713411 3:6898637-6898659 GATACCTCCCAAAAATAGGTTGG + Intronic
950735156 3:15001493-15001515 TAAAAAACACAAAAATAAGCCGG - Intronic
950738022 3:15026858-15026880 CAAAACACACAAAATTAGCTGGG - Intronic
951018359 3:17754773-17754795 AAAAACACACAAAAATTAGTCGG - Intronic
951507397 3:23463247-23463269 TAAACCAAACAACAATAAGGTGG + Intronic
951535541 3:23737225-23737247 TAAAACACAAAAAATTAGCTGGG - Intergenic
952376309 3:32770484-32770506 AAAAATACACAAAATTAGGTGGG - Intronic
953090702 3:39723214-39723236 TAAAACACAAAAAATTAGATGGG - Intergenic
953122695 3:40060750-40060772 AAAAACACACAAAATTAGCTGGG - Intronic
954019349 3:47725609-47725631 AAAAACACAAAAAAATAGCTGGG - Intronic
954048490 3:47952760-47952782 TAAAAAATACAAAAATTGGTCGG + Intronic
954192025 3:48970050-48970072 TAAAAAACACAAAAATTAGTTGG - Intronic
954423119 3:50429067-50429089 TAAAACACAAAAAAATAGCCAGG + Intronic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
955372749 3:58367842-58367864 AAAAACACACAAAAATTAGTTGG - Intronic
955437780 3:58921414-58921436 TAAAGCACACCAAAATGTGTGGG - Intronic
955851609 3:63225784-63225806 TAAAGCACACATATACAGGTGGG + Intergenic
955916852 3:63915095-63915117 TAAAACACAAAAAATTAGCTGGG - Intronic
956072138 3:65464412-65464434 TACAGCACATTAAAATAGGTGGG - Intronic
956329032 3:68084635-68084657 TAAAACATACAAAATTAGCTGGG + Intronic
956594069 3:70947533-70947555 TAAAACACACAAAGACAGGCTGG + Intergenic
957284073 3:78193967-78193989 TAAAACATACAAAAATTAGTAGG - Intergenic
957318395 3:78597451-78597473 TGAACCACAAAAAAAAAGGCTGG - Exonic
957419210 3:79947475-79947497 GAAAACACACAAAAAAAGGGTGG + Intergenic
958080363 3:88738599-88738621 TAAAATACAAAAAATTAGGTGGG + Intergenic
958713658 3:97750824-97750846 TAAAATATACAAAAAAAGGTAGG + Intronic
959047305 3:101488679-101488701 TAAAACACAAAAAATTAGCTGGG + Intronic
959238792 3:103760977-103760999 AAAACAAAACAAAAATAGCTGGG + Intergenic
959296942 3:104547477-104547499 CAAAACACACAAACAAAGGTGGG - Intergenic
959465091 3:106676401-106676423 AAAACGACACAAAAATGGCTGGG + Intergenic
962062835 3:131948864-131948886 AAAAACACACAAAAATAAATAGG + Intronic
962180944 3:133205930-133205952 TACACCAATCAAATATAGGTTGG + Intronic
963398521 3:144765507-144765529 TAAATCACAGAATAATAGATAGG + Intergenic
963891732 3:150643355-150643377 AAAACCACACAAAAATACCTAGG + Intergenic
964144695 3:153445020-153445042 TAAAACACAAAAAATTAGCTGGG + Intergenic
964311964 3:155403555-155403577 TAAAACACAAAAAATTAGCTGGG - Intronic
965405783 3:168266642-168266664 TTAAACAAACAAAAACAGGTAGG - Intergenic
965570122 3:170164039-170164061 AAAAACAAACAAAAATAGCTGGG + Intronic
965857800 3:173109621-173109643 TAAATTACACTAAAATATGTTGG + Intronic
967009705 3:185421356-185421378 TAAACTACAAAAAATTAGCTGGG - Intronic
967244660 3:187473669-187473691 TAAAACACAAAAAATTAGGCAGG + Intergenic
968242075 3:197099048-197099070 AAAACAAAACAAAAATATGTTGG - Intronic
970069712 4:12143808-12143830 AAAACAAAACAAAAATTGGTGGG + Intergenic
970948152 4:21719800-21719822 AAAACTACAAAAAATTAGGTGGG + Intronic
971118232 4:23673468-23673490 TAAACCAGGCAACAAAAGGTAGG - Intergenic
971403840 4:26301951-26301973 TAAAATACAAAAAAATAGCTGGG - Intronic
971718214 4:30209065-30209087 AAAAACACACAAAATTAGCTGGG + Intergenic
971905605 4:32721126-32721148 TAAACCAAAGAAACATGGGTAGG - Intergenic
972707432 4:41558985-41559007 AAAACCAAACAAAAATCTGTAGG - Intronic
972926454 4:44014866-44014888 AAAAACACAAAAAAATAGCTGGG + Intergenic
973385079 4:49505910-49505932 TTAACCAAACAAAGAAAGGTTGG - Intergenic
974350440 4:60737277-60737299 TAAAACATACAAAATTAGCTGGG - Intergenic
974368499 4:60984462-60984484 TGAAGCAAACAAAAGTAGGTGGG + Intergenic
975033095 4:69647926-69647948 TGAAACACACAAAAAAGGGTTGG - Intronic
975132131 4:70840463-70840485 TAAAATACAAAAAATTAGGTCGG + Intergenic
975473693 4:74797641-74797663 AAAACCACAAAAAATTAGCTGGG - Intergenic
976415632 4:84771130-84771152 AAAAACAAACAAAAAAAGGTGGG - Intronic
976708502 4:88043479-88043501 ACAACCACACAGAAATAGGAGGG - Intronic
976745161 4:88395129-88395151 TAAAACAAACAAAAATAATTGGG - Intronic
977229169 4:94431506-94431528 TAAAACACAAAAAATTAGCTGGG - Intergenic
977812036 4:101367414-101367436 TAAACCTCACAAAAATGTGGAGG - Intergenic
978102745 4:104862943-104862965 AAAACCTCACAAAAAAAAGTTGG - Intergenic
978313416 4:107410786-107410808 TATACCAATCAAACATAGGTTGG - Intergenic
978431393 4:108636660-108636682 AAAACAACACAAAAATACGCTGG - Intergenic
979140363 4:117164735-117164757 TAGGCCACACTTAAATAGGTAGG + Intergenic
980248056 4:130273385-130273407 GAAACCAGACCAAAGTAGGTAGG - Intergenic
980379761 4:131997401-131997423 TAAGTCACACAAACATAGCTTGG + Intergenic
980906536 4:138953641-138953663 TAAAAAACACAAAAATAAGCTGG - Intergenic
980976589 4:139616911-139616933 TCAACAACAAAAAAAGAGGTGGG - Intergenic
982185815 4:152797427-152797449 TCAAACACGCAAGAATAGGTAGG - Intronic
982210687 4:153032888-153032910 TAAAACACAAAAAATTAGCTGGG + Intergenic
982591033 4:157310936-157310958 TATTCAACACCAAAATAGGTGGG + Intronic
982766956 4:159359476-159359498 AAAACAACACAAAAATAGAGTGG - Exonic
983721806 4:170863675-170863697 AAAAACAAAGAAAAATAGGTTGG - Intergenic
983806483 4:171999485-171999507 TAAATCACAAGAAAATAAGTTGG + Intronic
984357095 4:178675541-178675563 TAAAAAACACAAAATTAGCTGGG + Intergenic
984384472 4:179037185-179037207 TAAAAAATACAAAAATAGCTGGG - Intergenic
984552535 4:181177953-181177975 TACAACACACAAAAATGTGTTGG - Intergenic
984668591 4:182455720-182455742 TAAAATACACAAAATTAGCTGGG - Intronic
985379783 4:189381081-189381103 TAAAAAACACAAAAATTAGTAGG + Intergenic
1202768937 4_GL000008v2_random:181244-181266 TTAACCAAACAAAGAAAGGTTGG - Intergenic
987261587 5:16209817-16209839 TAAACTACACAAAAGTAGAGAGG - Intergenic
987272867 5:16330399-16330421 CAAAACATACAAAAATAGCTGGG + Intergenic
988569986 5:32355464-32355486 TAAAAGACACAAAAATAGGGGGG + Exonic
988619994 5:32813094-32813116 CAAACAACAGAAAAATGGGTGGG - Intergenic
988952373 5:36276620-36276642 TAACCCACCCAAAATTAGGGGGG - Intronic
989214980 5:38894743-38894765 ACAACCACAAAAAAATAGTTGGG + Intronic
989222146 5:38979092-38979114 AACACCACACAAAAATAACTTGG - Intronic
989249814 5:39298765-39298787 AAAACCAAATAAAAATAGTTAGG + Intronic
990516004 5:56531426-56531448 CAAACCAAACAAGAAGAGGTGGG - Intronic
990581018 5:57167732-57167754 CAAACCAAAAAAAAACAGGTTGG - Intergenic
990593164 5:57286075-57286097 CAAACAACAAAAAAAAAGGTGGG + Intergenic
991071911 5:62492701-62492723 AAAACTACACAAAAATAGCTGGG - Intronic
991143724 5:63276840-63276862 CAAACCACATAAAAATATATAGG - Intergenic
991181585 5:63757665-63757687 TAAAATACACAAAATTAGCTGGG - Intergenic
991503209 5:67298093-67298115 GAAGGCACACAAAGATAGGTGGG - Intergenic
992285623 5:75232548-75232570 AAAAACACACAAAATTTGGTTGG - Intronic
992388173 5:76305882-76305904 TAAGGGACACAAAAAGAGGTGGG + Intronic
992967038 5:82013121-82013143 TAAAAAACACAAAAATTGGCCGG - Intronic
993186321 5:84626131-84626153 AAAACCACACATGACTAGGTAGG + Intergenic
993728792 5:91398231-91398253 TAAACCACACAAAAACCTTTGGG - Intergenic
994414284 5:99448609-99448631 TAAAAAACACAAAATTAGCTGGG + Intergenic
994491114 5:100444952-100444974 TAAAACAAACAAAAATCGGCCGG - Intergenic
994510510 5:100697492-100697514 AAAAATACAGAAAAATAGGTGGG - Intergenic
994533041 5:100990976-100990998 TAAAAAACACAAAAATAGCCTGG - Intergenic
995625004 5:114066739-114066761 TAAAACACACAAAAATTAGCTGG - Intergenic
996156175 5:120104778-120104800 TAAAACAGACAAAAATATGCTGG - Intergenic
996341185 5:122440907-122440929 AAATCCACACAAATGTAGGTAGG + Intronic
996364795 5:122689566-122689588 AAAAATACAAAAAAATAGGTGGG + Intergenic
997780254 5:136650688-136650710 AAAACCAAAGATAAATAGGTGGG - Intergenic
998070396 5:139193404-139193426 TAAATAACACAAAAATTAGTTGG + Intronic
999634789 5:153610300-153610322 CAAACCACAGAAAATGAGGTAGG + Intronic
999831101 5:155321002-155321024 AAAACCACAAAAAATTAGCTGGG - Intergenic
1000090467 5:157925601-157925623 TAAAAAACACAAAAATTAGTTGG + Intergenic
1000310619 5:160040745-160040767 AAAACCAAACAAAATTAGCTGGG - Intronic
1000800003 5:165714030-165714052 AAAACCACATTAAAATATGTTGG + Intergenic
1001291785 5:170468725-170468747 AAAACCACACAAAAATTAGCTGG + Intronic
1001764882 5:174237810-174237832 TAAACTACAAAAAATTAGCTGGG - Intronic
1002015530 5:176318946-176318968 AAAACCACAAAAAATTAGCTGGG + Intronic
1002718108 5:181241266-181241288 TAAAACACAAAAAATTAGCTAGG + Intronic
1003683154 6:8275620-8275642 GAAAGCACTCAAAAATAGGCCGG - Intergenic
1003793807 6:9577470-9577492 TAAAATACAAAAAATTAGGTGGG + Intergenic
1005300723 6:24467860-24467882 GAAACCACACAGAAATAGATTGG - Intronic
1005320361 6:24646789-24646811 TAAACCACAGAAAACTTGGGTGG + Intergenic
1006262503 6:32887048-32887070 AAAAGCACACAGTAATAGGTTGG - Intergenic
1006640519 6:35487122-35487144 CAAACCTCACAAAACTAGGCCGG + Intronic
1006963647 6:37960151-37960173 TAATCCTCAGAAAAATAAGTAGG - Intronic
1007577679 6:42936695-42936717 TAAAAAACACAAAAATTAGTCGG - Intronic
1008101327 6:47394337-47394359 TAAAATACACAAAATTAGCTGGG - Intergenic
1008750265 6:54724743-54724765 TAAAGCCCAGAAAAATTGGTAGG + Intergenic
1008883197 6:56402850-56402872 TAAAACACAAAAAATTAGCTGGG - Intergenic
1009552690 6:65119704-65119726 AAAAACAAACAAAAATAGCTAGG + Intronic
1009659979 6:66598772-66598794 TATTTCAGACAAAAATAGGTAGG + Intergenic
1009798191 6:68498990-68499012 TATACCACACAAAAAATGATGGG - Intergenic
1010231582 6:73539877-73539899 TAAAACACAAAAAATTAGCTGGG - Intergenic
1010239804 6:73604590-73604612 AAAAACACACAAAATTAGCTGGG + Intronic
1010437351 6:75849195-75849217 TAGACCACACATAAATGAGTGGG - Intronic
1011372960 6:86659541-86659563 AGAAGCACACAAAAATAGTTAGG + Intergenic
1011612194 6:89163475-89163497 AAAACCAAACAAAAATGGGCAGG - Exonic
1012324642 6:97901103-97901125 AAAAACACAAAAAAATAGCTGGG + Intergenic
1012917638 6:105187644-105187666 CAAAACACACAAAAATTAGTCGG + Intergenic
1013256495 6:108391640-108391662 AAAACCAAAGATAAATAGGTGGG - Intronic
1013804408 6:113981517-113981539 TAAACCACTTAAAAGTAGGTTGG + Intronic
1014045921 6:116886766-116886788 TAAAACAAAAAAAAATAGGCTGG + Intronic
1014053313 6:116982629-116982651 CAATCCACACAAAAATAGCAGGG - Intergenic
1014748079 6:125223293-125223315 GTAAGCACACAAAAATATGTTGG - Intronic
1015649054 6:135433530-135433552 TAACCAACAGCAAAATAGGTAGG - Intronic
1017545142 6:155442593-155442615 TCAACCACAAAGAAAGAGGTAGG + Intronic
1017625504 6:156343439-156343461 TAAAACACAAAAAATTAGCTGGG + Intergenic
1017895027 6:158672128-158672150 TAAAATACAAAAAATTAGGTGGG + Intronic
1018489459 6:164276587-164276609 TAACCCACACACATCTAGGTGGG + Intergenic
1020046326 7:5043503-5043525 TAAAACACAAAAAATTAGCTGGG - Intronic
1020053439 7:5099171-5099193 AAAAACACACACAAATAGCTAGG + Intergenic
1020062383 7:5162024-5162046 AAAAACACACAAAAATTAGTTGG + Intergenic
1020291683 7:6727418-6727440 TAAAACACAAAAAATTAGCTGGG - Intergenic
1020725573 7:11809469-11809491 GAAACCACACAAAAAAAGAAAGG - Intronic
1021281227 7:18720832-18720854 TAAACAACAAAAAAATTAGTTGG - Intronic
1021856086 7:24857785-24857807 AAAACAACACAAAAATCTGTTGG - Intronic
1022161107 7:27712120-27712142 TAAAAAACACAAAATTAGCTGGG - Intergenic
1022885520 7:34639589-34639611 TCAACAACAACAAAATAGGTCGG - Intergenic
1022986036 7:35654835-35654857 TAAAACCCACAAAAATTAGTTGG - Intronic
1023364271 7:39447586-39447608 TAATATACACAAAAACAGGTAGG + Intronic
1023686884 7:42745268-42745290 TAAACCACACAAGAATCTGTAGG + Intergenic
1023797080 7:43802657-43802679 AAAAACACACAAAATTAGGCGGG - Intronic
1024071770 7:45792297-45792319 TGATCCTCACAAAAACAGGTGGG + Intergenic
1024698061 7:51876820-51876842 TAAATAACACAAAATTGGGTGGG - Intergenic
1024770116 7:52712689-52712711 TAAACCTCACAAAAATGTGAGGG + Intergenic
1024973357 7:55090898-55090920 TAAAATACCCAAATATAGGTTGG - Intronic
1026087343 7:67273251-67273273 TAAAACACAAAAAATTAGCTGGG + Intergenic
1026726890 7:72876989-72877011 TAAAACACAAAAAATTAGCTGGG - Intergenic
1026744013 7:72997257-72997279 TAAAAAACACAAAAATTAGTCGG + Intergenic
1026804263 7:73419862-73419884 TAAAAAACACAAAAATTAGTCGG + Intergenic
1026813085 7:73485462-73485484 TAAAAAACACAAAAATCAGTTGG + Intronic
1026948469 7:74331732-74331754 TAAAAAACACAAAATTAGCTGGG - Intronic
1027030121 7:74881952-74881974 TAAAAAACACAAAAATTAGTCGG + Intergenic
1027099724 7:75367825-75367847 TAAAAAACACAAAAATTAGTCGG - Intergenic
1027465903 7:78514612-78514634 GAACCCACACAAAAATAAGCAGG + Intronic
1027945414 7:84738867-84738889 GAAAGGACACAAAAAAAGGTTGG + Intergenic
1028215918 7:88133199-88133221 TCAAAAATACAAAAATAGGTTGG + Intronic
1028364387 7:90010596-90010618 AAAAACACAAAAAAATAGCTGGG + Intergenic
1028829375 7:95310736-95310758 TAAATTATATAAAAATAGGTTGG + Intronic
1028954103 7:96669514-96669536 TAGGCCACACAAAAACAGGCAGG + Intronic
1029720560 7:102361431-102361453 TAAAACACAAAAAATTAGCTGGG - Intergenic
1030003161 7:105087582-105087604 TAAAACACAAAAAATTAGCTAGG - Intronic
1030242819 7:107347963-107347985 TAAAATACAAAAAAATAGCTAGG + Intronic
1030741560 7:113115774-113115796 TAAAACACACAAAAAAATGCAGG + Intergenic
1030991787 7:116309783-116309805 TGAGGCAGACAAAAATAGGTGGG + Intronic
1031076530 7:117218853-117218875 CAAACCTCACAAAACTGGGTGGG - Intronic
1031671172 7:124548426-124548448 CAAACCCAACAAAAACAGGTTGG + Intergenic
1031789043 7:126076326-126076348 TAAACCACAGAAAAGTATCTGGG - Intergenic
1032130025 7:129220344-129220366 AAAACCACAAAAAAACAGGCTGG + Intergenic
1032572415 7:133014297-133014319 TAAATCACACTAAAATTGTTTGG + Intronic
1032816430 7:135479733-135479755 TAAAAAACACAAAAATTAGTCGG + Intronic
1032901541 7:136315244-136315266 TAAAACACAAAAAATTAGCTGGG - Intergenic
1033209753 7:139452127-139452149 AAAAACACAAAAAAATAGCTGGG - Intergenic
1034738297 7:153449404-153449426 TAAATCAAATAAAAATATGTGGG + Intergenic
1035094240 7:156340633-156340655 TAAAACACAAAAAAATTGGCCGG + Intergenic
1035450139 7:158972686-158972708 AAAACCACAAAAAATTAGCTGGG - Intergenic
1036053997 8:5230055-5230077 TAAAACACAAAAAATTAGCTGGG - Intergenic
1036178192 8:6559479-6559501 TAAACAACACAAGAACAGGCTGG - Intronic
1036399772 8:8397710-8397732 TAAAATACACAAAATTAGCTGGG - Intergenic
1036646567 8:10614498-10614520 AAAAGCACAAAAAAATAGCTGGG + Intronic
1036720288 8:11167988-11168010 TAATCCCTACAAAAATAGTTGGG + Intronic
1038812552 8:30864450-30864472 TAAACATCTAAAAAATAGGTAGG + Intronic
1039182054 8:34878032-34878054 TAAAACAAACAAAAACAGGAAGG + Intergenic
1039210351 8:35206082-35206104 TAGAACAAATAAAAATAGGTAGG + Intergenic
1039856650 8:41421004-41421026 TAAAACATACAAAATTAGCTGGG - Intergenic
1040514738 8:48125705-48125727 TTAAAAACACAAAAATTGGTGGG - Intergenic
1041334861 8:56770503-56770525 TAAAGCTCACAAAAATGTGTAGG + Intergenic
1041638201 8:60167378-60167400 TAAAACAAAGAAAAATAGCTGGG + Intergenic
1041651151 8:60304704-60304726 TACACAACACATAAATAGATAGG + Intergenic
1041892912 8:62891217-62891239 TAAAGCAGACAGAAAAAGGTGGG + Intronic
1042211425 8:66384851-66384873 TAAACCATACAAGTATAGTTGGG + Intergenic
1042594489 8:70432024-70432046 TCAAGCACACAAAATTAGGGAGG + Intergenic
1042737125 8:72001938-72001960 TAAAGGACACACTAATAGGTGGG + Intronic
1042884361 8:73531424-73531446 TAAACCAGATAAAAATATGTAGG + Intronic
1043328135 8:79078790-79078812 TAAAAAACACAAAAATTAGTTGG - Intergenic
1043763799 8:84103964-84103986 GAAACAATACAAAAATAAGTAGG + Intergenic
1044120446 8:88387611-88387633 TAAAACACAAAAAATTAGCTGGG - Intergenic
1044395831 8:91710561-91710583 TCAGCCACACAAAAGTAGCTGGG - Intergenic
1044732653 8:95242962-95242984 TAAGCCACACAGAAAGAGGCAGG + Intergenic
1045076080 8:98570287-98570309 TAAAAAACACAAAATTAGCTAGG - Intronic
1045856228 8:106768792-106768814 AAAAACACACAAAAATAGCTAGG - Intronic
1046174992 8:110563802-110563824 CAAACCAAAAAAAAATGGGTAGG + Intergenic
1047088263 8:121543791-121543813 TAACCTACACAAGTATAGGTTGG - Intergenic
1047157938 8:122342467-122342489 AAAACAAAAAAAAAATAGGTGGG - Intergenic
1047563580 8:126015438-126015460 TGAACTACACATAAATAGGATGG + Intergenic
1048603107 8:135939975-135939997 TAAAACCCACAAAAGTATGTGGG + Intergenic
1049091306 8:140516307-140516329 TAAAAAATACAAAAATAGGTTGG - Exonic
1049737842 8:144219316-144219338 TAAAAAATACAAAAATTGGTCGG - Intronic
1051112421 9:13654455-13654477 TAAAATACAAAAAATTAGGTGGG - Intergenic
1052474793 9:28944997-28945019 TAAACAAAACAAATATAGGCTGG + Intergenic
1052582056 9:30370628-30370650 TAAACAATACAATAATAGTTTGG - Intergenic
1052761119 9:32592344-32592366 AAAAACACATAAAAATATGTGGG + Intergenic
1053119155 9:35532583-35532605 AAAACCACAAAAATATAGCTGGG + Intronic
1053287044 9:36856318-36856340 TAAAACACACAAAGAGAAGTGGG + Intronic
1054761760 9:69011220-69011242 TAAAAAATACAAAAATAGCTGGG - Intergenic
1055205044 9:73718981-73719003 TAAACAACTGAAAAATAAGTTGG + Intergenic
1056038355 9:82633905-82633927 TAAACTACAAAAAAACAAGTTGG + Intergenic
1056168255 9:83958811-83958833 CAAAACACAAAAAATTAGGTGGG + Intergenic
1056200682 9:84273106-84273128 TAATCCTCACAAAAATATGAGGG + Intergenic
1057117869 9:92542675-92542697 TAAAATACACAAAATTAGCTGGG - Intronic
1057118656 9:92550233-92550255 TAAAATACACAAAATTAGCTGGG + Intronic
1057775064 9:98001169-98001191 TAAACCAGAAAAAAAAAGGGGGG - Intronic
1057780375 9:98044950-98044972 TAAAACACAAAAAATTAGCTGGG + Intergenic
1057823825 9:98356891-98356913 CAAACCACAAAAATATATGTAGG + Intronic
1058093759 9:100836331-100836353 TAAAAAATACAAAAATTGGTTGG - Intergenic
1058524777 9:105845800-105845822 TAAAACACAAAAAATTAGCTGGG + Intergenic
1058675617 9:107397624-107397646 CAGACCACACAAAAACAGGCCGG - Intergenic
1058987299 9:110220199-110220221 AAAACCACAAAAAATTAGCTGGG + Intergenic
1059071663 9:111144207-111144229 GAAAACAAACAAAAATATGTAGG - Intergenic
1059252310 9:112896266-112896288 GAAACCACACAAAAAAACATAGG - Intergenic
1059844100 9:118252133-118252155 TAAACTACACACACATAGGAAGG - Intergenic
1060562899 9:124561613-124561635 TAAAAGACAAAAAAATTGGTGGG + Intronic
1060691222 9:125662520-125662542 TAAAATACACAAAATTAGCTGGG + Intronic
1060744398 9:126121044-126121066 TAAACCACCACAAAATAAGTGGG + Intergenic
1061434170 9:130550524-130550546 TAAAACACAAAAAATTAGTTGGG - Intergenic
1061988520 9:134144541-134144563 AAAAAAACACAAAAACAGGTTGG + Intronic
1203626730 Un_KI270750v1:32451-32473 AAAACAACAGAAAAATAGTTTGG - Intergenic
1185800408 X:3005534-3005556 CAAACAATACAAAAATAGCTGGG - Intergenic
1187158326 X:16742125-16742147 AAAACCACACAAAAATTAGCTGG - Intronic
1187379386 X:18786620-18786642 TAAAATACAAAAAAATAGCTGGG + Intronic
1188398363 X:29714445-29714467 TAAATTACAGAAAAATAGCTTGG + Intronic
1188945817 X:36300448-36300470 TAAAACACAGAAAATTAGCTGGG - Intronic
1189992882 X:46611392-46611414 TAAATGACAAAAAAATATGTAGG - Intronic
1190202147 X:48371456-48371478 TAAAATACAAAAAATTAGGTGGG - Intergenic
1190208391 X:48423957-48423979 TAAAATACAAAAAATTAGGTGGG + Intergenic
1190550472 X:51574708-51574730 TGATCCACACAGAAATATGTTGG - Intergenic
1190749548 X:53349464-53349486 TAAAAAACACAAAATTAGCTGGG + Intergenic
1191690187 X:63931500-63931522 TAAAACACAAAAAATTAGCTGGG + Intergenic
1193090142 X:77485052-77485074 AAAAACACAAAAAATTAGGTGGG + Intergenic
1193985340 X:88234482-88234504 TGAAGCACACAAAAATAATTTGG - Intergenic
1194454149 X:94081327-94081349 AAAAACAAAGAAAAATAGGTGGG - Intergenic
1194682892 X:96875736-96875758 TTAACCACACAAAAAAATGTAGG - Intronic
1194979029 X:100421603-100421625 TATACCAAAAAAAAAGAGGTTGG + Intergenic
1195374470 X:104213550-104213572 AAAAATACAAAAAAATAGGTGGG - Intergenic
1195538494 X:106035744-106035766 CAAACCACACATAGATAGATTGG - Intronic
1197143821 X:123148186-123148208 TAAAATACACAAAATTAGCTGGG + Intergenic
1197213790 X:123849442-123849464 TAAAATACACAAAATTAGCTGGG + Intergenic
1197687598 X:129458296-129458318 CAGGCCACACAAAAACAGGTGGG + Intronic
1197931526 X:131701048-131701070 TAAAAAATACAAAAATAGGCCGG + Intergenic
1199175767 X:144785300-144785322 TAAAACTCACAAAAATGGGGAGG - Intergenic
1199225001 X:145363062-145363084 AAAACCACAAAAAATTAGTTGGG - Intergenic
1199257020 X:145728942-145728964 AAAAGCACACAAAATTAGGCAGG - Intergenic
1199320516 X:146432611-146432633 ACAACCACATAAAAAAAGGTGGG + Intergenic
1199510809 X:148619868-148619890 TAAAGCAAACAAAAATATGCTGG - Intronic
1199591591 X:149472755-149472777 ATAACCACACAAAAACAGTTTGG + Intergenic
1199774691 X:151000502-151000524 CAAAACAAACAAAAATAGTTGGG + Intergenic
1199876422 X:151932392-151932414 AAAACCAAACAAAATTAGCTAGG - Intergenic
1199900852 X:152170472-152170494 TAAAAAACAAAAAAATAGCTGGG - Intronic
1199964286 X:152806922-152806944 TAAAACACAATAAAATAGGCCGG + Intergenic
1200130666 X:153842669-153842691 TAAAACAGACAAAAAAAGGCCGG - Intergenic
1201367028 Y:13218569-13218591 TTAACCACAAAAAAAAAGGAAGG + Intergenic
1201497195 Y:14601260-14601282 AAAACCACCAAAAATTAGGTGGG - Intronic
1202046643 Y:20742343-20742365 TAAAACACAAAAAATTAGCTGGG + Intergenic