ID: 1158939768

View in Genome Browser
Species Human (GRCh38)
Location 18:62396541-62396563
Sequence AAGGGAAATAAGCATGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158939768_1158939773 -5 Left 1158939768 18:62396541-62396563 CCTTCCCCATGCTTATTTCCCTT No data
Right 1158939773 18:62396559-62396581 CCCTTAAGAGTTTTAATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158939768 Original CRISPR AAGGGAAATAAGCATGGGGA AGG (reversed) Intergenic
No off target data available for this crispr