ID: 1158939773

View in Genome Browser
Species Human (GRCh38)
Location 18:62396559-62396581
Sequence CCCTTAAGAGTTTTAATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158939761_1158939773 17 Left 1158939761 18:62396519-62396541 CCCCCTTTGCTCCACTTGCCCGC No data
Right 1158939773 18:62396559-62396581 CCCTTAAGAGTTTTAATGAAAGG No data
1158939763_1158939773 15 Left 1158939763 18:62396521-62396543 CCCTTTGCTCCACTTGCCCGCCT No data
Right 1158939773 18:62396559-62396581 CCCTTAAGAGTTTTAATGAAAGG No data
1158939769_1158939773 -9 Left 1158939769 18:62396545-62396567 CCCCATGCTTATTTCCCTTAAGA No data
Right 1158939773 18:62396559-62396581 CCCTTAAGAGTTTTAATGAAAGG No data
1158939767_1158939773 -2 Left 1158939767 18:62396538-62396560 CCGCCTTCCCCATGCTTATTTCC No data
Right 1158939773 18:62396559-62396581 CCCTTAAGAGTTTTAATGAAAGG No data
1158939766_1158939773 -1 Left 1158939766 18:62396537-62396559 CCCGCCTTCCCCATGCTTATTTC No data
Right 1158939773 18:62396559-62396581 CCCTTAAGAGTTTTAATGAAAGG No data
1158939764_1158939773 14 Left 1158939764 18:62396522-62396544 CCTTTGCTCCACTTGCCCGCCTT No data
Right 1158939773 18:62396559-62396581 CCCTTAAGAGTTTTAATGAAAGG No data
1158939765_1158939773 6 Left 1158939765 18:62396530-62396552 CCACTTGCCCGCCTTCCCCATGC No data
Right 1158939773 18:62396559-62396581 CCCTTAAGAGTTTTAATGAAAGG No data
1158939770_1158939773 -10 Left 1158939770 18:62396546-62396568 CCCATGCTTATTTCCCTTAAGAG No data
Right 1158939773 18:62396559-62396581 CCCTTAAGAGTTTTAATGAAAGG No data
1158939762_1158939773 16 Left 1158939762 18:62396520-62396542 CCCCTTTGCTCCACTTGCCCGCC No data
Right 1158939773 18:62396559-62396581 CCCTTAAGAGTTTTAATGAAAGG No data
1158939768_1158939773 -5 Left 1158939768 18:62396541-62396563 CCTTCCCCATGCTTATTTCCCTT No data
Right 1158939773 18:62396559-62396581 CCCTTAAGAGTTTTAATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158939773 Original CRISPR CCCTTAAGAGTTTTAATGAA AGG Intergenic
No off target data available for this crispr