ID: 1158940309

View in Genome Browser
Species Human (GRCh38)
Location 18:62401491-62401513
Sequence CACTCCAATCTGGGCGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158940309_1158940314 -6 Left 1158940309 18:62401491-62401513 CCTCCGTCGCCCAGATTGGAGTG No data
Right 1158940314 18:62401508-62401530 GGAGTGCAGTGGCACGATCCCGG 0: 247
1: 19622
2: 88808
3: 143956
4: 140833
1158940309_1158940317 16 Left 1158940309 18:62401491-62401513 CCTCCGTCGCCCAGATTGGAGTG No data
Right 1158940317 18:62401530-62401552 GCTCACTGCAACCTCCTACCAGG 0: 3
1: 60
2: 250
3: 504
4: 1067

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158940309 Original CRISPR CACTCCAATCTGGGCGACGG AGG (reversed) Intergenic
No off target data available for this crispr