ID: 1158941534

View in Genome Browser
Species Human (GRCh38)
Location 18:62409646-62409668
Sequence TGGAGGATGCACTTTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158941530_1158941534 1 Left 1158941530 18:62409622-62409644 CCGTGTGATGAAGGAAGCAGAGA No data
Right 1158941534 18:62409646-62409668 TGGAGGATGCACTTTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158941534 Original CRISPR TGGAGGATGCACTTTGAGGA TGG Intergenic
No off target data available for this crispr